Transcript: Human NM_001167882.2

Homo sapiens ankyrin repeat domain 50 (ANKRD50), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ANKRD50 (57182)
Length:
7523
CDS:
301..4053

Additional Resources:

NCBI RefSeq record:
NM_001167882.2
NBCI Gene record:
ANKRD50 (57182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183859 CGGAATTATATCACGCAGTAT pLKO.1 863 CDS 100% 4.950 6.930 N ANKRD50 n/a
2 TRCN0000147727 GCGAAGATATGACATTGCATA pLKO.1 6178 3UTR 100% 4.950 6.930 N ANKRD50 n/a
3 TRCN0000442876 GACCTTCGGAAGGCATATATC pLKO_005 529 CDS 100% 13.200 10.560 N ANKRD50 n/a
4 TRCN0000182888 CAGTACATTCTTCATCGTTTA pLKO.1 565 CDS 100% 10.800 7.560 N ANKRD50 n/a
5 TRCN0000183146 CCCTGAATAATTCATTGACTA pLKO.1 4955 3UTR 100% 4.950 3.465 N ANKRD50 n/a
6 TRCN0000182962 CCTTTCATATTAGCTTCACAA pLKO.1 2410 CDS 100% 4.950 3.465 N ANKRD50 n/a
7 TRCN0000183226 GCCTGTTTCTTGTATCTTTAA pLKO.1 4504 3UTR 100% 13.200 7.920 N ANKRD50 n/a
8 TRCN0000424108 TGATGTTGTTCAGGTCTTATT pLKO_005 2937 CDS 100% 13.200 7.920 N ANKRD50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12334 pDONR223 100% 59.4% 59.4% None 1_1521del n/a
2 ccsbBroad304_12334 pLX_304 0% 59.4% 59.4% V5 1_1521del n/a
3 TRCN0000465722 GGGTTTTAACGACCCCGTAGCAAT pLX_317 18.1% 59.4% 59.4% V5 1_1521del n/a
Download CSV