Transcript: Human NM_001167911.2

Homo sapiens ventricular zone expressed PH domain containing 1 (VEPH1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
VEPH1 (79674)
Length:
4056
CDS:
298..2664

Additional Resources:

NCBI RefSeq record:
NM_001167911.2
NBCI Gene record:
VEPH1 (79674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431457 TGACCAGGCAGTAGTTGAAAT pLKO_005 456 CDS 100% 13.200 18.480 N VEPH1 n/a
2 TRCN0000150121 CCAAGCTCATAGTAACTGAAA pLKO.1 1472 CDS 100% 4.950 6.930 N VEPH1 n/a
3 TRCN0000128741 CCAAGGTAACACCATGTTGTT pLKO.1 822 CDS 100% 4.950 6.930 N VEPH1 n/a
4 TRCN0000149678 GCCTATACAGTAAGTCCAGTT pLKO.1 2093 CDS 100% 4.050 5.670 N VEPH1 n/a
5 TRCN0000413769 ACTTCTGTAGATATGTCATTT pLKO_005 2967 3UTR 100% 13.200 9.240 N VEPH1 n/a
6 TRCN0000219788 AGCATTCGTTTCACCATATTC pLKO.1 1256 CDS 100% 13.200 9.240 N VEPH1 n/a
7 TRCN0000434874 GACAGATGGCAAGGATTTATG pLKO_005 1160 CDS 100% 13.200 9.240 N VEPH1 n/a
8 TRCN0000432339 GTATTGACTTCAGAATATATC pLKO_005 2853 3UTR 100% 13.200 9.240 N VEPH1 n/a
9 TRCN0000419679 TAGTAAATGTCATACTCTAAC pLKO_005 2825 3UTR 100% 10.800 7.560 N VEPH1 n/a
10 TRCN0000149978 CCAATAGAACTCAGCAAAGTA pLKO.1 2449 CDS 100% 5.625 3.938 N VEPH1 n/a
11 TRCN0000150024 CCCATAATGACATCATCCTAA pLKO.1 1043 CDS 100% 4.950 3.465 N VEPH1 n/a
12 TRCN0000150108 CCTATACAGTAAGTCCAGTTT pLKO.1 2094 CDS 100% 4.950 3.465 N VEPH1 n/a
13 TRCN0000146848 CAATTATACACCACAGGCATT pLKO.1 2686 3UTR 100% 4.050 2.835 N VEPH1 n/a
14 TRCN0000128302 GAGCTAAATTTACCAAGCCAT pLKO.1 2735 3UTR 100% 2.640 1.848 N VEPH1 n/a
15 TRCN0000219789 CACATATCTGTAGGGATTTAT pLKO.1 2652 CDS 100% 15.000 9.000 N VEPH1 n/a
16 TRCN0000423961 CAGTTTCATACCCAAATATTA pLKO_005 1817 CDS 100% 15.000 9.000 N VEPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04106 pDONR223 100% 94.5% 94.5% None 1873_1874ins135 n/a
2 ccsbBroad304_04106 pLX_304 0% 94.5% 94.5% V5 1873_1874ins135 n/a
3 TRCN0000472697 CAATACCTGCAAAGTACAACAGAT pLX_317 16.6% 94.5% 94.5% V5 1873_1874ins135 n/a
4 ccsbBroadEn_15987 pDONR223 0% 24.9% 22.4% None (many diffs) n/a
5 ccsbBroad304_15987 pLX_304 0% 24.9% 22.4% V5 (many diffs) n/a
6 TRCN0000471028 CCGGGAAATGGTCAAATTATAAAT pLX_317 67.5% 24.9% 22.4% V5 (many diffs) n/a
Download CSV