Transcript: Human NM_001168368.2

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 16 (GALNT16), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
GALNT16 (57452)
Length:
4108
CDS:
134..1810

Additional Resources:

NCBI RefSeq record:
NM_001168368.2
NBCI Gene record:
GALNT16 (57452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034931 GTGATCGACAAGTCCTGGTTT pLKO.1 1025 CDS 100% 4.950 6.930 N GALNT16 n/a
2 TRCN0000251574 TGGGCACTTTCTACTACTTAT pLKO_005 186 CDS 100% 13.200 10.560 N Galnt16 n/a
3 TRCN0000034930 CCCTCACCTACATCAGGAATA pLKO.1 1212 CDS 100% 10.800 7.560 N GALNT16 n/a
4 TRCN0000034932 CAGATGTGCAACCCTAGAGAA pLKO.1 1643 CDS 100% 4.950 3.465 N GALNT16 n/a
5 TRCN0000034929 CCTGGGCACTTTCTACTACTT pLKO.1 184 CDS 100% 4.950 3.465 N GALNT16 n/a
6 TRCN0000034933 TGCCAACTTGATCCAGGAGAT pLKO.1 586 CDS 100% 4.050 2.835 N GALNT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03820 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03820 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472542 TGTCCACTACAGTGACAAGGTTTC pLX_317 30.6% 100% 100% V5 n/a
Download CSV