Transcript: Mouse NM_001168382.1

Mus musculus PHD finger protein 14 (Phf14), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Phf14 (75725)
Length:
3381
CDS:
415..3240

Additional Resources:

NCBI RefSeq record:
NM_001168382.1
NBCI Gene record:
Phf14 (75725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177584 CCATCAGACAAACAGTTAATT pLKO.1 682 CDS 100% 15.000 21.000 N Phf14 n/a
2 TRCN0000019309 CGCATGATTCAAATTCAGGAA pLKO.1 2278 CDS 100% 2.640 3.696 N PHF14 n/a
3 TRCN0000312505 CGCATGATTCAAATTCAGGAA pLKO_005 2278 CDS 100% 2.640 3.696 N PHF14 n/a
4 TRCN0000219623 GGCCTTACTTGGCCGAATTAC pLKO.1 2442 CDS 100% 13.200 10.560 N Phf14 n/a
5 TRCN0000219622 ACAGTTCATGAAGGTTGTTAT pLKO.1 1426 CDS 100% 13.200 9.240 N Phf14 n/a
6 TRCN0000198236 GACACCTGTAAACTGCATTAT pLKO.1 2623 CDS 100% 13.200 9.240 N Phf14 n/a
7 TRCN0000182147 CGAGCACCTAAGGAAAGGAAA pLKO.1 2494 CDS 100% 4.950 3.465 N Phf14 n/a
8 TRCN0000181846 GCTTTGCTAGAACTGGAGTTT pLKO.1 1736 CDS 100% 4.950 3.465 N Phf14 n/a
9 TRCN0000222119 GCAATGATGAAGATCATAGTA pLKO.1 1154 CDS 100% 0.563 0.788 N PHF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07464 pDONR223 100% 84.8% 89.8% None (many diffs) n/a
2 ccsbBroad304_07464 pLX_304 0% 84.8% 89.8% V5 (many diffs) n/a
3 TRCN0000476554 CCACGAACTAGCCATATCATCTGC pLX_317 15.5% 84.8% 89.8% V5 (many diffs) n/a
Download CSV