Transcript: Human NM_001168393.2

Homo sapiens CREB3 regulatory factor (CREBRF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CREBRF (153222)
Length:
2466
CDS:
316..1569

Additional Resources:

NCBI RefSeq record:
NM_001168393.2
NBCI Gene record:
CREBRF (153222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435561 ACCCACTTCAAGCACACAAAT pLKO_005 933 CDS 100% 13.200 9.240 N CREBRF n/a
2 TRCN0000431955 AGACCAACATGTATCATAATG pLKO_005 962 CDS 100% 13.200 9.240 N CREBRF n/a
3 TRCN0000434868 TCCAACTTTAGCTCAACTTAA pLKO_005 723 CDS 100% 13.200 9.240 N CREBRF n/a
4 TRCN0000168109 CCAGTACATCAGTCTCAGATT pLKO.1 1277 CDS 100% 4.950 3.465 N CREBRF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09694 pDONR223 100% 64.5% 64% None (many diffs) n/a
2 ccsbBroad304_09694 pLX_304 0% 64.5% 64% V5 (many diffs) n/a
3 TRCN0000479310 TAACTTGGCACGGGCCATGCGCCC pLX_317 23.5% 64.5% 64% V5 (many diffs) n/a
Download CSV