Transcript: Mouse NM_001170433.1

Mus musculus PTPRF interacting protein, binding protein 1 (liprin beta 1) (Ppfibp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ppfibp1 (67533)
Length:
4893
CDS:
310..3252

Additional Resources:

NCBI RefSeq record:
NM_001170433.1
NBCI Gene record:
Ppfibp1 (67533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182026 CGGAATCATAGCAGGTTCTAA pLKO.1 360 CDS 100% 5.625 7.875 N Ppfibp1 n/a
2 TRCN0000197523 CCTTTGCTAAACTCATCATTA pLKO.1 4086 3UTR 100% 13.200 9.240 N Ppfibp1 n/a
3 TRCN0000002957 CGGTTAGAGCAGATGGAAGAT pLKO.1 3088 CDS 100% 4.950 3.465 N PPFIBP1 n/a
4 TRCN0000181895 GCACTCATATACCCATCAGAA pLKO.1 3989 3UTR 100% 4.950 3.465 N Ppfibp1 n/a
5 TRCN0000181654 GTAGAAACTATGGCCCAGTTA pLKO.1 2755 CDS 100% 4.950 3.465 N Ppfibp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07246 pDONR223 100% 82% 85.5% None (many diffs) n/a
2 ccsbBroad304_07246 pLX_304 0% 82% 85.5% V5 (many diffs) n/a
3 TRCN0000480925 TGCATACCACCTTCAATACTCTAT pLX_317 13.7% 82% 85.5% V5 (many diffs) n/a
Download CSV