Transcript: Human NM_001170588.2

Homo sapiens hedgehog acyltransferase (HHAT), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
HHAT (55733)
Length:
3446
CDS:
243..1529

Additional Resources:

NCBI RefSeq record:
NM_001170588.2
NBCI Gene record:
HHAT (55733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422901 TTGATGTTGGACTGCATAATT pLKO_005 1060 CDS 100% 15.000 21.000 N HHAT n/a
2 TRCN0000422181 CACTTTATTTGGAGGATTAAA pLKO_005 377 CDS 100% 15.000 12.000 N HHAT n/a
3 TRCN0000422431 ACTGGATGCTGGATCTCATAG pLKO_005 1661 3UTR 100% 10.800 7.560 N HHAT n/a
4 TRCN0000035601 CGTGAGCACCATGTTCAGTTT pLKO.1 1019 CDS 100% 4.950 3.465 N HHAT n/a
5 TRCN0000035600 GCCACATGGTAGTGTCTCAAA pLKO.1 472 CDS 100% 4.950 3.465 N HHAT n/a
6 TRCN0000035603 TCTTCATACAAGGCTGGCCTT pLKO.1 1426 CDS 100% 2.160 1.512 N HHAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08572 pDONR223 100% 86.6% 86.6% None 270_271ins195;339G>C;350G>A n/a
2 ccsbBroad304_08572 pLX_304 0% 86.6% 86.6% V5 270_271ins195;339G>C;350G>A n/a
3 TRCN0000475311 ACGTCTAAACTGCGCTGTATTCCT pLX_317 22.3% 86.6% 86.6% V5 270_271ins195;339G>C;350G>A n/a
Download CSV