Transcript: Human NM_001170754.1

Homo sapiens chromosome 1 open reading frame 127 (C1orf127), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C1orf127 (148345)
Length:
2779
CDS:
1..2472

Additional Resources:

NCBI RefSeq record:
NM_001170754.1
NBCI Gene record:
C1orf127 (148345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173048 CCTGAACGACCTGAATCACTT pLKO.1 1573 CDS 100% 4.950 3.465 N C1orf127 n/a
2 TRCN0000172496 CCATTCCTGCAAACAGCCAAA pLKO.1 1303 CDS 100% 4.050 2.835 N C1orf127 n/a
3 TRCN0000172495 CTGACTGAAGGTCTAGGAACT pLKO.1 1618 CDS 100% 4.050 2.835 N C1orf127 n/a
4 TRCN0000172356 CTGGCAGTTCTTCCTATGGAA pLKO.1 2095 CDS 100% 3.000 2.100 N C1orf127 n/a
5 TRCN0000172695 GCAGTTCTTCCTATGGAACCT pLKO.1 2098 CDS 100% 2.640 1.848 N C1orf127 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13249 pDONR223 100% 78.6% 78.7% None (many diffs) n/a
2 ccsbBroad304_13249 pLX_304 0% 78.6% 78.7% V5 (many diffs) n/a
3 TRCN0000471399 TAACACATAACCTCGGTGGGTAGG pLX_317 18.4% 78.6% 78.7% V5 (many diffs) n/a
Download CSV