Transcript: Mouse NM_001170907.1

Mus musculus thyroid hormone receptor interactor 4 (Trip4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trip4 (56404)
Length:
6253
CDS:
146..1765

Additional Resources:

NCBI RefSeq record:
NM_001170907.1
NBCI Gene record:
Trip4 (56404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095996 CCCAAGTTATTGACGATGAAT pLKO.1 984 CDS 100% 5.625 4.500 N Trip4 n/a
2 TRCN0000095994 CGTGGGAAAGATGTGGAGTTT pLKO.1 1619 CDS 100% 4.950 3.960 N Trip4 n/a
3 TRCN0000095997 CCTGGATGTCAGCGAGGAAAT pLKO.1 220 CDS 100% 10.800 7.560 N Trip4 n/a
4 TRCN0000095998 GTGGAGTTTCCAAATGACTAT pLKO.1 1631 CDS 100% 4.950 3.465 N Trip4 n/a
5 TRCN0000095995 CGAGAATATGTGACAGACCTT pLKO.1 281 CDS 100% 2.640 1.848 N Trip4 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 5328 3UTR 100% 4.950 2.475 Y Gad2 n/a
7 TRCN0000022138 CCTTTGGGAGTTCTGGTAAAT pLKO.1 1268 CDS 100% 13.200 9.240 N TRIP4 n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5269 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07388 pDONR223 100% 81.9% 78.9% None (many diffs) n/a
2 ccsbBroad304_07388 pLX_304 0% 81.9% 78.9% V5 (many diffs) n/a
3 TRCN0000480651 TCTCTGACGTCAGCACCCCTAAAA pLX_317 23.9% 81.9% 78.9% V5 (many diffs) n/a
Download CSV