Transcript: Mouse NM_001170967.1

Mus musculus WD repeat domain 33 (Wdr33), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Wdr33 (74320)
Length:
1148
CDS:
222..989

Additional Resources:

NCBI RefSeq record:
NM_001170967.1
NBCI Gene record:
Wdr33 (74320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294668 CAGCCGGATGCAGGTTATTAT pLKO_005 468 CDS 100% 15.000 21.000 N Wdr33 n/a
2 TRCN0000123608 CCACGGATAATAAATTTGCTA pLKO.1 856 CDS 100% 3.000 4.200 N Wdr33 n/a
3 TRCN0000074841 GCACATAAGGAGGCGATTAGA pLKO.1 819 CDS 100% 5.625 3.938 N WDR33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03586 pDONR223 100% 66.6% 59.2% None (many diffs) n/a
2 ccsbBroad304_03586 pLX_304 0% 66.6% 59.2% V5 (many diffs) n/a
3 TRCN0000475255 AATACCATTAGAACGTGCGCCAGA pLX_317 49.5% 66.6% 59.2% V5 (many diffs) n/a
Download CSV