Transcript: Human NM_001171976.1

Homo sapiens cadherin related family member 2 (CDHR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CDHR2 (54825)
Length:
4313
CDS:
275..4207

Additional Resources:

NCBI RefSeq record:
NM_001171976.1
NBCI Gene record:
CDHR2 (54825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117865 CGTGAATGTGAAAGACGTGAA pLKO.1 2659 CDS 100% 4.050 5.670 N CDHR2 n/a
2 TRCN0000117866 GCGCCAACAGACAGGCGATTA pLKO.1 3456 CDS 100% 3.600 5.040 N CDHR2 n/a
3 TRCN0000117862 CCATCCACCTTAGAGACATTA pLKO.1 1674 CDS 100% 13.200 9.240 N CDHR2 n/a
4 TRCN0000117864 CCCAGGGACTAACATGTACAA pLKO.1 3898 CDS 100% 4.950 3.465 N CDHR2 n/a
5 TRCN0000117863 GCTGGAGATACAGCTTGTGAA pLKO.1 2797 CDS 100% 4.950 3.465 N CDHR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08415 pDONR223 100% 99.8% 99.8% None (many diffs) n/a
2 ccsbBroad304_08415 pLX_304 0% 99.8% 99.8% V5 (many diffs) n/a
3 TRCN0000477590 GTATAGCCGTACGGTTCGCTTAGA pLX_317 11.1% 99.8% 99.8% V5 (many diffs) n/a
Download CSV