Transcript: Mouse NM_001172098.1

Mus musculus striatin, calmodulin binding protein 3 (Strn3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Strn3 (94186)
Length:
3912
CDS:
212..2350

Additional Resources:

NCBI RefSeq record:
NM_001172098.1
NBCI Gene record:
Strn3 (94186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001172098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375064 CACTGGTAGTGCGGTAATTTA pLKO_005 1912 CDS 100% 15.000 21.000 N Strn3 n/a
2 TRCN0000036950 CCTGTTACAATAACTGCTCAT pLKO.1 2036 CDS 100% 4.050 5.670 N STRN3 n/a
3 TRCN0000075627 GCTGGCACTTTAGTTGCTCAT pLKO.1 1691 CDS 100% 4.050 5.670 N Strn3 n/a
4 TRCN0000363788 GCTGGCACTTTAGTTGCTCAT pLKO_005 1691 CDS 100% 4.050 5.670 N Strn3 n/a
5 TRCN0000375117 AGCAAGGCAGACAGCTATTAA pLKO_005 729 CDS 100% 15.000 10.500 N Strn3 n/a
6 TRCN0000075623 CTCCAGTATCTGTGCCCTATA pLKO.1 2559 3UTR 100% 10.800 7.560 N Strn3 n/a
7 TRCN0000335452 CTCCAGTATCTGTGCCCTATA pLKO_005 2559 3UTR 100% 10.800 7.560 N Strn3 n/a
8 TRCN0000075625 GCCATGTGTTTGCACTTACAA pLKO.1 1813 CDS 100% 5.625 3.938 N Strn3 n/a
9 TRCN0000335384 GCCATGTGTTTGCACTTACAA pLKO_005 1813 CDS 100% 5.625 3.938 N Strn3 n/a
10 TRCN0000075624 CCTGCCAATAAAGATGCCTTT pLKO.1 1334 CDS 100% 4.050 2.835 N Strn3 n/a
11 TRCN0000335383 CCTGCCAATAAAGATGCCTTT pLKO_005 1334 CDS 100% 4.050 2.835 N Strn3 n/a
12 TRCN0000075626 GCCTGCCAATAAAGATGCCTT pLKO.1 1333 CDS 100% 2.640 1.848 N Strn3 n/a
13 TRCN0000365146 GATTCTGGTTTACAATCTAAT pLKO_005 1979 CDS 100% 13.200 9.240 N STRN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08151 pDONR223 100% 92.2% 96% None (many diffs) n/a
2 ccsbBroad304_08151 pLX_304 0% 92.2% 96% V5 (many diffs) n/a
3 TRCN0000476900 CGCTTCTAATTCGATCTACTAGGA pLX_317 17.9% 92.2% 96% V5 (many diffs) n/a
Download CSV