Transcript: Mouse NM_001172099.1

Mus musculus CUE domain containing 1 (Cuedc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cuedc1 (103841)
Length:
2991
CDS:
269..1444

Additional Resources:

NCBI RefSeq record:
NM_001172099.1
NBCI Gene record:
Cuedc1 (103841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001172099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257811 GTGTCAGAAGATGCCTTATTC pLKO_005 1166 CDS 100% 13.200 9.240 N Cuedc1 n/a
2 TRCN0000248802 TGGAGAGAGACCGATTGAAAT pLKO_005 1050 CDS 100% 13.200 9.240 N Cuedc1 n/a
3 TRCN0000248803 ACATGGACTACGACATCATTG pLKO_005 459 CDS 100% 10.800 7.560 N Cuedc1 n/a
4 TRCN0000248801 ATGGACGACTTCAAGACTATG pLKO_005 431 CDS 100% 10.800 7.560 N Cuedc1 n/a
5 TRCN0000191150 CTTTCAGAGCTGCTTATGATT pLKO.1 1624 3UTR 100% 5.625 3.938 N Cuedc1 n/a
6 TRCN0000190711 GCTTTCCACAGACAGGACTTA pLKO.1 1600 3UTR 100% 4.950 3.465 N Cuedc1 n/a
7 TRCN0000200508 CAAGACTATGTTTCCTAACAT pLKO.1 442 CDS 100% 0.563 0.394 N Cuedc1 n/a
8 TRCN0000248800 ACCAAGGCTCAGGCTTCTTCA pLKO_005 1552 3UTR 100% 4.950 2.970 N Cuedc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10143 pDONR223 100% 83.2% 85.7% None (many diffs) n/a
2 ccsbBroad304_10143 pLX_304 0% 83.2% 85.7% V5 (many diffs) n/a
3 TRCN0000475640 AACCTGAAGTGCTCCCGGAGCTAG pLX_317 16.4% 83.2% 85.7% V5 (many diffs) n/a
Download CSV