Transcript: Human NM_001172435.2

Homo sapiens RAB3 GTPase activating protein catalytic subunit 1 (RAB3GAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RAB3GAP1 (22930)
Length:
4912
CDS:
17..2983

Additional Resources:

NCBI RefSeq record:
NM_001172435.2
NBCI Gene record:
RAB3GAP1 (22930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279656 AGAGGAGTCACCGCTAAATAA pLKO_005 1207 CDS 100% 15.000 21.000 N RAB3GAP1 n/a
2 TRCN0000279655 GTACGAACTGATTTCGAAATG pLKO_005 572 CDS 100% 10.800 15.120 N RAB3GAP1 n/a
3 TRCN0000162733 CGGATGAAGATTCCAAGCAAT pLKO.1 2198 CDS 100% 4.950 6.930 N RAB3GAP1 n/a
4 TRCN0000279654 CGGATGAAGATTCCAAGCAAT pLKO_005 2198 CDS 100% 4.950 6.930 N RAB3GAP1 n/a
5 TRCN0000158907 CGAAGAATGTATGTAGGAGAA pLKO.1 536 CDS 100% 4.050 3.240 N RAB3GAP1 n/a
6 TRCN0000279657 ACACTTCGTGGTTCTATATAT pLKO_005 3352 3UTR 100% 15.000 10.500 N RAB3GAP1 n/a
7 TRCN0000158954 GAAGGGATCATTGTGGATAAT pLKO.1 884 CDS 100% 13.200 9.240 N RAB3GAP1 n/a
8 TRCN0000162815 CCCTAGAGATGGCCTTTGTAT pLKO.1 3205 3UTR 100% 5.625 3.938 N RAB3GAP1 n/a
9 TRCN0000158953 GAAGTCTTGAATGACTGGAAA pLKO.1 110 CDS 100% 4.950 3.465 N RAB3GAP1 n/a
10 TRCN0000161634 GCCTCCAGTTAGTATTGCTAT pLKO.1 685 CDS 100% 4.950 3.465 N RAB3GAP1 n/a
11 TRCN0000161038 GCATTTGAGGAAGAAGGCAAA pLKO.1 1061 CDS 100% 4.050 2.835 N RAB3GAP1 n/a
12 TRCN0000164426 CCTCAGTGTTTGCTAGGTGAT pLKO.1 974 CDS 100% 4.050 2.430 N RAB3GAP1 n/a
13 TRCN0000297252 CCTCAGTGTTTGCTAGGTGAT pLKO_005 974 CDS 100% 4.050 2.430 N RAB3GAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15001 pDONR223 53.7% 99.1% 98.9% None (many diffs) n/a
2 ccsbBroad304_15001 pLX_304 0% 99.1% 98.9% V5 (many diffs) n/a
3 ccsbBroadEn_14072 pDONR223 100% 92.9% 75.3% None (many diffs) n/a
4 ccsbBroad304_14072 pLX_304 0% 92.9% 75.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000475693 CAAAATATCGTACATTACTGCAAT pLX_317 11.1% 92.9% 75.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV