Transcript: Human NM_001172735.3

Homo sapiens protein phosphatase 1 regulatory subunit 16B (PPP1R16B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R16B (26051)
Length:
6133
CDS:
198..1775

Additional Resources:

NCBI RefSeq record:
NM_001172735.3
NBCI Gene record:
PPP1R16B (26051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257320 CGTTAGGTTCTGCGGATAAAG pLKO_005 4466 3UTR 100% 13.200 18.480 N PPP1R16B n/a
2 TRCN0000231619 TCGGATGGGAACATGCCATAT pLKO_005 690 CDS 100% 10.800 15.120 N PPP1R16B n/a
3 TRCN0000006920 CAGTGCTGCATCGACAACTTT pLKO.1 516 CDS 100% 5.625 7.875 N PPP1R16B n/a
4 TRCN0000006917 CCAAGAGAATAAGGACCCTAA pLKO.1 1247 CDS 100% 4.050 5.670 N PPP1R16B n/a
5 TRCN0000231621 GCAATGGGACCTCGGTATATT pLKO_005 1660 CDS 100% 15.000 10.500 N PPP1R16B n/a
6 TRCN0000231620 CCCGTGCTACTCTCCGAATTT pLKO_005 1284 CDS 100% 13.200 9.240 N PPP1R16B n/a
7 TRCN0000231618 TCGACAACTTTGAGGAAATTG pLKO_005 526 CDS 100% 13.200 9.240 N PPP1R16B n/a
8 TRCN0000006916 GCTGTATTTAACTCTTGCTAT pLKO.1 5518 3UTR 100% 4.950 3.465 N PPP1R16B n/a
9 TRCN0000103623 CCCTGATTTGTGCAATGAGGA pLKO.1 476 CDS 100% 2.640 1.848 N Ppp1r16b n/a
10 TRCN0000006919 CCTCGGTATATTACACGGTCA pLKO.1 1669 CDS 100% 2.160 1.512 N PPP1R16B n/a
11 TRCN0000006918 GCTGAAGAAATGGGCACAGTA pLKO.1 296 CDS 100% 4.950 2.970 N PPP1R16B n/a
12 TRCN0000103624 CCTGATTTGTGCAATGAGGAT pLKO.1 477 CDS 100% 2.640 1.848 N Ppp1r16b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07980 pDONR223 100% 92.5% 92.5% None 695_696ins126 n/a
2 ccsbBroad304_07980 pLX_304 0% 92.5% 92.5% V5 695_696ins126 n/a
3 TRCN0000480319 ACCTTTCTTGTTACCCCCAAACTA pLX_317 20.6% 92.5% 92.5% V5 695_696ins126 n/a
Download CSV