Construct: ORF TRCN0000480319
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015076.1_s317c1
- Derived from:
- ccsbBroadEn_07980
- DNA Barcode:
- ACCTTTCTTGTTACCCCCAAACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPP1R16B (26051)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480319
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26051 | PPP1R16B | protein phosphatase 1 regul... | NM_015568.4 | 99.9% | 100% | 750C>T |
| 2 | human | 26051 | PPP1R16B | protein phosphatase 1 regul... | NM_001172735.3 | 92.5% | 92.5% | 695_696ins126 |
| 3 | human | 26051 | PPP1R16B | protein phosphatase 1 regul... | XM_011528768.3 | 91% | 82.3% | (many diffs) |
| 4 | human | 26051 | PPP1R16B | protein phosphatase 1 regul... | XM_011528769.2 | 64.8% | 64.9% | 0_1ins597;153C>T |
| 5 | human | 26051 | PPP1R16B | protein phosphatase 1 regul... | XM_017027785.1 | 64.8% | 64.9% | 0_1ins597;153C>T |
| 6 | mouse | 228852 | Ppp1r16b | protein phosphatase 1, regu... | NM_001159662.1 | 89.8% | 96.3% | (many diffs) |
| 7 | mouse | 228852 | Ppp1r16b | protein phosphatase 1, regu... | NM_153089.4 | 89.8% | 96.3% | (many diffs) |
| 8 | mouse | 228852 | Ppp1r16b | protein phosphatase 1, regu... | XM_011239492.2 | 89.8% | 96.3% | (many diffs) |
| 9 | mouse | 228852 | Ppp1r16b | protein phosphatase 1, regu... | XM_011239493.1 | 76.3% | 62% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1770
- ORF length:
- 1701
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccagtcac gtggacctgc tgacggagct gcagctgctg gagaaggtgc 121 ccacgctgga gcggctgcgg gctgcccaga agcgccgggc ccagcagctg aagaaatggg 181 cacagtacga gcaggacttg cagcaccgca agcgaaagca tgagcggaag cgcagcacgg 241 gcggccgccg caagaaagtg tccttcgagg ccagcgtggc cctgctggag gcctcgctga 301 ggaacgacgc cgaggaagta cgctacttcc tgaagaataa ggtcagccct gatttgtgca 361 atgaggacgg actcacagcc ctacaccagt gctgcatcga caactttgag gaaattgtga 421 agctgctcct ctcccatggt gccaatgtga acgccaagga caacgagctg tggacacctc 481 tccatgctgc agccacctgc ggccacatca acctggtgaa gatcctcgtt cagtatgggg 541 ccgacttgct tgctgtcaac tcggatggga acatgccata tgacctctgc gaggatgaac 601 ccaccctgga tgtcatcgag acctgcatgg cataccaggg catcacccaa gagaaaatca 661 acgagatgcg ggtggctcct gagcagcaga tgattgcgga catccactgc atgatcgcag 721 cgggccagga cctggactgg atagatgccc agggtgccac actgctgcac atagctggag 781 ccaatggata cctgcgggca gctgagctcc tcctggatca tggagtgcgt gtggatgtga 841 aggactggga tggctgggag cccctgcatg cagctgcctt ctggggacag atgcagatgg 901 cagagctatt ggtgtcccat ggagctagtc tcagtgcaag gacatccatg gatgagatgc 961 caatagacct gtgcgaggag gaagagttca aggtcctgct gctggagcta aaacacaagc 1021 atgatgtgat catgaagtca cagctgaggc acaagtcatc cttgagccgg aggacctcca 1081 gcgcaggcag ccgtgggaag gtggtgcggc gagccagcct gtcggacagg accaacctgt 1141 ataggaagga gtatgaggga gaggccatcc tgtggcagcg gagtgcagct gaggatcagc 1201 ggacctccac ctacaacggg gacatcaggg agaccaggac agaccaagag aataaggacc 1261 ctaaccccag gctggagaag cccgtgctac tctccgaatt tcctaccaag atcccacgag 1321 gtgaactgga catgcctgtt gagaatggcc tccgggctcc ggtcagtgcc taccagtatg 1381 cgctggccaa cggggatgtc tggaaggtgc atgaggtgcc tgacTACAGC ATGGCCTATG 1441 GCAACCCTGG CGTGGCCGAC GCCACCCCGC CCTGGAGCAG CTACAAGGAA CAGAGCCCTC 1501 AGACGCTTCT GGAGCTGAAG CGGCAGCGGG CTGCAGCCAA GCTGCTCAGC CACCCCTTCC 1561 TTAGCACACA CCTGGGCAGC AGCATGGCCA GGACGGGCGA GAGTAGCAGT GAAGGCAAGG 1621 CCCCCTTGAT CGGAGGCAGA ACTTCACCGT ACAGCAGCAA TGGGACCTCG GTATATTACA 1681 CGGTCACCAG CGGAGATCCC CCACTCTTAA AGTTCAAGGC CCCCATAGAG GAGATGGAGG 1741 AGAAGGTGCA TGGCTGTTGC CGTATCTCCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1801 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1861 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAACCTT 1921 TCTTGTTACC CCCAAACTAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1981 tgaaagatt