Transcript: Human NM_001172813.2

Homo sapiens solute carrier family 30 member 8 (SLC30A8), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC30A8 (169026)
Length:
5537
CDS:
542..1504

Additional Resources:

NCBI RefSeq record:
NM_001172813.2
NBCI Gene record:
SLC30A8 (169026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364288 ACCGTCAGTTTCCCAAATTTG pLKO_005 1514 3UTR 100% 13.200 18.480 N SLC30A8 n/a
2 TRCN0000364354 ACTATCGGCAATACCAAATTC pLKO_005 1780 3UTR 100% 13.200 18.480 N SLC30A8 n/a
3 TRCN0000364286 CACATCTGGTCTCTAACAATG pLKO_005 1304 CDS 100% 10.800 15.120 N SLC30A8 n/a
4 TRCN0000042887 CGACTGTGATGATCATCGTTT pLKO.1 918 CDS 100% 4.950 6.930 N SLC30A8 n/a
5 TRCN0000364358 CTGTATGCTAACGCCACATTA pLKO_005 1957 3UTR 100% 13.200 10.560 N SLC30A8 n/a
6 TRCN0000042886 CCGGTGAATAAAGATCAGTGT pLKO.1 485 5UTR 100% 2.640 2.112 N SLC30A8 n/a
7 TRCN0000042884 GTGGTGTGAAAGAGCTTATTT pLKO.1 1248 CDS 100% 15.000 10.500 N SLC30A8 n/a
8 TRCN0000174073 GTGGTGTGAAAGAGCTTATTT pLKO.1 1248 CDS 100% 15.000 10.500 N SLC30A8 n/a
9 TRCN0000364284 TACTTTAAGCCAGAGTATAAA pLKO_005 1109 CDS 100% 15.000 10.500 N SLC30A8 n/a
10 TRCN0000364359 CCAGCACCATCACTATCTTAA pLKO_005 1176 CDS 100% 13.200 9.240 N SLC30A8 n/a
11 TRCN0000376469 GAGTATCAGTGTGCTAATTAG pLKO_005 1075 CDS 100% 13.200 9.240 N SLC30A8 n/a
12 TRCN0000364356 GCATGCCCTTGGAGATCTATT pLKO_005 1051 CDS 100% 13.200 9.240 N SLC30A8 n/a
13 TRCN0000364283 GCGCCTGCTGTATCCTGATTA pLKO_005 886 CDS 100% 13.200 9.240 N SLC30A8 n/a
14 TRCN0000364360 TCCAACAGAAACCGGTGAATA pLKO_005 474 5UTR 100% 13.200 9.240 N SLC30A8 n/a
15 TRCN0000042883 GCCAGCACCATCACTATCTTA pLKO.1 1175 CDS 100% 5.625 3.938 N SLC30A8 n/a
16 TRCN0000042885 CACAAGGAAGTACAAGCCAAT pLKO.1 1007 CDS 100% 4.050 2.835 N SLC30A8 n/a
17 TRCN0000174072 CACAAGGAAGTACAAGCCAAT pLKO.1 1007 CDS 100% 4.050 2.835 N SLC30A8 n/a
18 TRCN0000364361 CTTGAGAACACATAGGTAAAT pLKO_005 1822 3UTR 100% 13.200 7.920 N SLC30A8 n/a
19 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 181 5UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172813.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05148 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05148 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471717 TACAAAAACCTTAAGCATCTTGAA pLX_317 41% 100% 100% V5 n/a
Download CSV