Transcript: Human NM_001172828.2

Homo sapiens YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
YTHDF2 (51441)
Length:
2719
CDS:
307..1896

Additional Resources:

NCBI RefSeq record:
NM_001172828.2
NBCI Gene record:
YTHDF2 (51441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254336 CGGTCCATTAATAACTATAAC pLKO_005 1333 CDS 100% 13.200 18.480 N YTHDF2 n/a
2 TRCN0000254411 CCACAGGCAAGGCCCAATAAT pLKO_005 274 5UTR 100% 15.000 10.500 N YTHDF2 n/a
3 TRCN0000176726 CTAGAGAACAACGAGAATAAA pLKO.1 1699 CDS 100% 15.000 10.500 N Ythdf2 n/a
4 TRCN0000254412 TCTGGATATAGTAGCAATTAT pLKO_005 595 CDS 100% 15.000 10.500 N YTHDF2 n/a
5 TRCN0000254410 TACTGATTAAGTCAGGATTAA pLKO_005 2513 3UTR 100% 13.200 9.240 N YTHDF2 n/a
6 TRCN0000168751 GCAGACTTGCAGTTTAAGTAT pLKO.1 2012 3UTR 100% 5.625 3.938 N YTHDF2 n/a
7 TRCN0000167813 GATGGATTAAACGATGATGAT pLKO.1 235 5UTR 100% 4.950 3.465 N YTHDF2 n/a
8 TRCN0000168709 GACTTCTCACACTATGAGAAA pLKO.1 1822 CDS 100% 0.495 0.347 N YTHDF2 n/a
9 TRCN0000265510 GCTACTCTGAGGACGATATTC pLKO_005 1406 CDS 100% 13.200 7.920 N YTHDF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03308 pDONR223 100% 91.3% 91.3% None 0_1ins150 n/a
2 ccsbBroad304_03308 pLX_304 0% 91.3% 91.3% V5 0_1ins150 n/a
3 TRCN0000468616 CAACCGAAACATCCGAAGCTCAAG pLX_317 18.5% 91.3% 91.3% V5 0_1ins150 n/a
Download CSV