Transcript: Human NM_001173534.2

Homo sapiens DiGeorge syndrome critical region gene 2 (DGCR2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DGCR2 (9993)
Length:
4306
CDS:
207..1727

Additional Resources:

NCBI RefSeq record:
NM_001173534.2
NBCI Gene record:
DGCR2 (9993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001173534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060406 TGCTACGAGAAGTCTTCATTT pLKO.1 843 CDS 100% 13.200 18.480 N DGCR2 n/a
2 TRCN0000240514 ACCCGGACAGTGTGTTCTATG pLKO_005 1441 CDS 100% 10.800 15.120 N DGCR2 n/a
3 TRCN0000240513 TAAGCGGGTTCTGTGCGATTT pLKO_005 2902 3UTR 100% 10.800 15.120 N DGCR2 n/a
4 TRCN0000240511 ACCTCCCTACACGGCATACAA pLKO_005 1364 CDS 100% 5.625 7.875 N DGCR2 n/a
5 TRCN0000245373 GCAAGTTGTGGGTTGGCTATC pLKO_005 619 CDS 100% 6.000 4.200 N DGCR2 n/a
6 TRCN0000060404 CCAGATGGCAACAGTCTGTTT pLKO.1 1077 CDS 100% 4.950 3.465 N DGCR2 n/a
7 TRCN0000060405 TGGAGCAAACTTGCACCACTT pLKO.1 1223 CDS 100% 4.050 2.835 N DGCR2 n/a
8 TRCN0000060403 GTATGTTATCACTGGCCGGAA pLKO.1 641 CDS 100% 2.160 1.512 N DGCR2 n/a
9 TRCN0000240512 CAGCTTCAGTGCTTCCATTTC pLKO_005 777 CDS 100% 10.800 6.480 N DGCR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02283 pDONR223 100% 92% 91.8% None 75_76ins123;205_206insGTTTCCTAG n/a
2 ccsbBroad304_02283 pLX_304 0% 92% 91.8% V5 75_76ins123;205_206insGTTTCCTAG n/a
3 ccsbBroadEn_15688 pDONR223 0% 91.9% 91.6% None 75_76ins123;205_206insGTTTCCTAG;1417C>A n/a
4 ccsbBroad304_15688 pLX_304 0% 91.9% 91.6% V5 75_76ins123;205_206insGTTTCCTAG;1417C>A n/a
5 TRCN0000465317 TACGGATACCTTGCGCACCCCACG pLX_317 11.5% 91.9% 91.6% V5 75_76ins123;205_206insGTTTCCTAG;1417C>A n/a
Download CSV