Transcript: Mouse NM_001177840.1

Mus musculus spermine oxidase (Smox), transcript variant 9, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Smox (228608)
Length:
1095
CDS:
202..774

Additional Resources:

NCBI RefSeq record:
NM_001177840.1
NBCI Gene record:
Smox (228608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076715 CCTATCTATCAACTAGCAGAA pLKO.1 463 CDS 100% 4.050 5.670 N Smox n/a
2 TRCN0000076713 CCGTGCTCTTAATTTCCTAAT pLKO.1 848 3UTR 100% 10.800 8.640 N Smox n/a
3 TRCN0000427086 CCACACACCGCAAGTACTACT pLKO_005 665 CDS 100% 4.950 3.465 N Smox n/a
4 TRCN0000416073 AGGTGTCCTCACTGCCAAATG pLKO_005 776 3UTR 100% 10.800 6.480 N Smox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08385 pDONR223 99.1% 32.8% 36.2% None (many diffs) n/a
2 ccsbBroad304_08385 pLX_304 0% 32.8% 36.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08386 pDONR223 100% 32.8% 36.2% None (many diffs) n/a
4 ccsbBroad304_08386 pLX_304 0% 32.8% 36.2% V5 (many diffs) n/a
5 TRCN0000476984 CTGTCCATAGCTTCTTATCGACTG pLX_317 22% 32.8% 36.2% V5 (many diffs) n/a
Download CSV