Construct: ORF TRCN0000476984
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017336.1_s317c1
- Derived from:
- ccsbBroadEn_08386
- DNA Barcode:
- CTGTCCATAGCTTCTTATCGACTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMOX (54498)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476984
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54498 | SMOX | spermine oxidase | NM_175840.3 | 99.8% | 100% | 1017A>G;1353A>G |
| 2 | human | 54498 | SMOX | spermine oxidase | NM_175842.3 | 94.2% | 94.3% | 1017A>G;1353A>G;1371_1460del |
| 3 | human | 54498 | SMOX | spermine oxidase | NM_175839.3 | 90.3% | 90.4% | 844_1002del;1176A>G;1512A>G |
| 4 | human | 54498 | SMOX | spermine oxidase | NM_001270691.1 | 85.6% | 85.8% | (many diffs) |
| 5 | human | 54498 | SMOX | spermine oxidase | XM_011529261.2 | 85.6% | 85.8% | (many diffs) |
| 6 | human | 54498 | SMOX | spermine oxidase | NM_175841.3 | 37.8% | 37.8% | 434_435ins936 |
| 7 | mouse | 228608 | Smox | spermine oxidase | NM_145533.2 | 81.8% | 87% | (many diffs) |
| 8 | mouse | 228608 | Smox | spermine oxidase | NM_001177833.1 | 77.6% | 82.5% | (many diffs) |
| 9 | mouse | 228608 | Smox | spermine oxidase | XM_006499287.3 | 77.6% | 82.5% | (many diffs) |
| 10 | mouse | 228608 | Smox | spermine oxidase | XM_006499288.2 | 77.6% | 82.5% | (many diffs) |
| 11 | mouse | 228608 | Smox | spermine oxidase | XM_006499289.3 | 77.4% | 82.3% | (many diffs) |
| 12 | mouse | 228608 | Smox | spermine oxidase | NM_001177836.1 | 75.6% | 80% | (many diffs) |
| 13 | mouse | 228608 | Smox | spermine oxidase | XM_006499290.1 | 75.6% | 79.4% | (many diffs) |
| 14 | mouse | 228608 | Smox | spermine oxidase | NM_001177834.1 | 75.6% | 68.6% | (many diffs) |
| 15 | mouse | 228608 | Smox | spermine oxidase | NM_001177835.1 | 71.7% | 69.2% | (many diffs) |
| 16 | mouse | 228608 | Smox | spermine oxidase | XM_006499291.1 | 71.4% | 75.5% | (many diffs) |
| 17 | mouse | 228608 | Smox | spermine oxidase | NM_001177837.1 | 69.8% | 73.7% | (many diffs) |
| 18 | mouse | 228608 | Smox | spermine oxidase | XM_017317769.1 | 68.7% | 72.5% | (many diffs) |
| 19 | mouse | 228608 | Smox | spermine oxidase | XM_006499293.3 | 64.8% | 68.4% | (many diffs) |
| 20 | mouse | 228608 | Smox | spermine oxidase | XM_006499292.3 | 54.1% | 58.4% | (many diffs) |
| 21 | mouse | 228608 | Smox | spermine oxidase | XM_011239475.1 | 50.7% | 49.2% | (many diffs) |
| 22 | mouse | 228608 | Smox | spermine oxidase | NM_001177838.1 | 45.4% | 46.8% | (many diffs) |
| 23 | mouse | 228608 | Smox | spermine oxidase | NM_001177839.1 | 44.4% | 39.9% | (many diffs) |
| 24 | mouse | 228608 | Smox | spermine oxidase | XR_374452.1 | 38.2% | (many diffs) | |
| 25 | mouse | 228608 | Smox | spermine oxidase | NM_001177840.1 | 32.8% | 36.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1572
- ORF length:
- 1506
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca aagttgtgaa tccagtggtg acagtgcgga tgaccctctc agtcgcggcc 121 tacggagaag gggacagcct cgtgtggtgg tgatcggcgc cggcttggct ggcctggctg 181 cagccaaagc acttcttgag cagggtttca cggatgtcac tgtgcttgag gcttccagcc 241 acatcggagg ccgtgtgcag agtgtgaaac ttggacacgc cacctttgag ctgggagcca 301 cctggatcca tggctcccat gggaacccta tctatcatct agcagaagcc aacggcctcc 361 tggaagagac aaccgatggg gaacgcagcg tgggccgcat cagcctctat tccaagaatg 421 gcgtggcctg ctaccttacc aaccacggcc gcaggatccc caaggacgtg gttgaggaat 481 tcagcgattt atacaacgag gtctataact tgacccagga gttcttccgg cacgataaac 541 cagtcaatgc tgaaagtcaa aatagcgtgg gggtgttcac ccgagaggag gtgcgtaacc 601 gcatcaggaa tgaccctgac gacccagagg ctaccaagcg cctgaagctc gccatgatcc 661 agcagtacct gaaggtggag agctgtgaga gcagctcaca cagcatggac gaggtgtccc 721 tgagcgcctt cggggagtgg accgagatcc ccggcgctca ccacatcatc ccctcgggct 781 tcatgcgggt tgtggagctg ctggcggagg gcatccctgc ccacgtcatc cagctaggga 841 aacctgtccg ctgcattcac tgggaccagg cctcagcccg ccccagaggc cctgagattg 901 agccccgggg tgtgctaaag aggcagtaca ccagtttctt ccggccaggc ctgcccacag 961 agaaggtggc tgccatccac cgcctgggca ttggcaccac cgacaagatc tttctggaat 1021 tcgaggagcc cttctggggc cctgagtgca acagcctaca gtttgtgtgg gaggacgaag 1081 cggagagcca caccctcacc tacccacctg agctctggta ccgcaagatc tgcggctttg 1141 atgtcctcta cccgcctgag cgctacggcc atgtgctgag cggctggatc tgcggggagg 1201 aggccctcgt catggagaag tgtgatgacg aggcagtggc cgagaTCTGC ACGGAGATGC 1261 TGCGTCAGTT CACAGGGAAC CCCAACATTC CAAAACCTCG GCGAATCTTG CGCTCGGCCT 1321 GGGGCAGCAA CCCTTACTTC CGCGGCTCCT ATTCATACAC GCAGGTGGGC TCCAGCGGGG 1381 CGGATGTGGA GAAGCTGGCC AAGCCCCTGC CGTACACGGA GAGCTCAAAG ACAGCGCCCA 1441 TGCAGGTGCT GTTTTCCGGT GAGGCCACCC ACCGCAAGTA CTATTCCACC ACCCACGGTG 1501 CTCTGCTGTC CGGCCAGCGT GAGGCTGCCC GCCTCATTGA GATGTACCGA GACCTCTTCC 1561 AGCAGGGGAC CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1621 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1681 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTG TCCATAGCTT CTTATCGACT 1741 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t