Construct: ORF TRCN0000476984

Construct Description:

Construct Type:
ORF
Other Identifiers:
ORF017336.1_s317c1
Derived from:
ccsbBroadEn_08386
DNA Barcode:
CTGTCCATAGCTTCTTATCGACTG
Epitope Tag:
V5
Notes:
No stop codon in insert

Originally Annotated References:

Gene:
SMOX (54498)

Vector Information:

Vector Backbone:
pLX_317
Pol II Cassette 1:
SV40-PuroR
Pol II Cassette 2:
EF1a-TRCN0000476984
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
n/a

Current transcripts matched by this ORF:

Taxon Gene Symbol Description Transcript Nuc. Match %[?] Prot. Match %[?] Match Diffs[?]
1 human 54498 SMOX spermine oxidase NM_175840.3 99.8% 100% 1017A>G;1353A>G
2 human 54498 SMOX spermine oxidase NM_175842.3 94.2% 94.3% 1017A>G;1353A>G;1371_1460del
3 human 54498 SMOX spermine oxidase NM_175839.3 90.3% 90.4% 844_1002del;1176A>G;1512A>G
4 human 54498 SMOX spermine oxidase NM_001270691.1 85.6% 85.8% (many diffs)
5 human 54498 SMOX spermine oxidase XM_011529261.2 85.6% 85.8% (many diffs)
6 human 54498 SMOX spermine oxidase NM_175841.3 37.8% 37.8% 434_435ins936
7 mouse 228608 Smox spermine oxidase NM_145533.2 81.8% 87% (many diffs)
8 mouse 228608 Smox spermine oxidase NM_001177833.1 77.6% 82.5% (many diffs)
9 mouse 228608 Smox spermine oxidase XM_006499287.3 77.6% 82.5% (many diffs)
10 mouse 228608 Smox spermine oxidase XM_006499288.2 77.6% 82.5% (many diffs)
11 mouse 228608 Smox spermine oxidase XM_006499289.3 77.4% 82.3% (many diffs)
12 mouse 228608 Smox spermine oxidase NM_001177836.1 75.6% 80% (many diffs)
13 mouse 228608 Smox spermine oxidase XM_006499290.1 75.6% 79.4% (many diffs)
14 mouse 228608 Smox spermine oxidase NM_001177834.1 75.6% 68.6% (many diffs)
15 mouse 228608 Smox spermine oxidase NM_001177835.1 71.7% 69.2% (many diffs)
16 mouse 228608 Smox spermine oxidase XM_006499291.1 71.4% 75.5% (many diffs)
17 mouse 228608 Smox spermine oxidase NM_001177837.1 69.8% 73.7% (many diffs)
18 mouse 228608 Smox spermine oxidase XM_017317769.1 68.7% 72.5% (many diffs)
19 mouse 228608 Smox spermine oxidase XM_006499293.3 64.8% 68.4% (many diffs)
20 mouse 228608 Smox spermine oxidase XM_006499292.3 54.1% 58.4% (many diffs)
21 mouse 228608 Smox spermine oxidase XM_011239475.1 50.7% 49.2% (many diffs)
22 mouse 228608 Smox spermine oxidase NM_001177838.1 45.4% 46.8% (many diffs)
23 mouse 228608 Smox spermine oxidase NM_001177839.1 44.4% 39.9% (many diffs)
24 mouse 228608 Smox spermine oxidase XR_374452.1 38.2% (many diffs)
25 mouse 228608 Smox spermine oxidase NM_001177840.1 32.8% 36.2% (many diffs)
Download CSV

Sequence Information

Note: uppercase bases indicate empirically verified sequence.

ORF start:
66
ORF end:
1572
ORF length:
1506
Sequence:
1tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag
61ttggcatgca aagttgtgaa tccagtggtg acagtgcgga tgaccctctc agtcgcggcc
121tacggagaag gggacagcct cgtgtggtgg tgatcggcgc cggcttggct ggcctggctg
181cagccaaagc acttcttgag cagggtttca cggatgtcac tgtgcttgag gcttccagcc
241acatcggagg ccgtgtgcag agtgtgaaac ttggacacgc cacctttgag ctgggagcca
301cctggatcca tggctcccat gggaacccta tctatcatct agcagaagcc aacggcctcc
361tggaagagac aaccgatggg gaacgcagcg tgggccgcat cagcctctat tccaagaatg
421gcgtggcctg ctaccttacc aaccacggcc gcaggatccc caaggacgtg gttgaggaat
481tcagcgattt atacaacgag gtctataact tgacccagga gttcttccgg cacgataaac
541cagtcaatgc tgaaagtcaa aatagcgtgg gggtgttcac ccgagaggag gtgcgtaacc
601gcatcaggaa tgaccctgac gacccagagg ctaccaagcg cctgaagctc gccatgatcc
661agcagtacct gaaggtggag agctgtgaga gcagctcaca cagcatggac gaggtgtccc
721tgagcgcctt cggggagtgg accgagatcc ccggcgctca ccacatcatc ccctcgggct
781tcatgcgggt tgtggagctg ctggcggagg gcatccctgc ccacgtcatc cagctaggga
841aacctgtccg ctgcattcac tgggaccagg cctcagcccg ccccagaggc cctgagattg
901agccccgggg tgtgctaaag aggcagtaca ccagtttctt ccggccaggc ctgcccacag
961agaaggtggc tgccatccac cgcctgggca ttggcaccac cgacaagatc tttctggaat
1021tcgaggagcc cttctggggc cctgagtgca acagcctaca gtttgtgtgg gaggacgaag
1081cggagagcca caccctcacc tacccacctg agctctggta ccgcaagatc tgcggctttg
1141atgtcctcta cccgcctgag cgctacggcc atgtgctgag cggctggatc tgcggggagg
1201aggccctcgt catggagaag tgtgatgacg aggcagtggc cgagaTCTGC ACGGAGATGC
1261TGCGTCAGTT CACAGGGAAC CCCAACATTC CAAAACCTCG GCGAATCTTG CGCTCGGCCT
1321GGGGCAGCAA CCCTTACTTC CGCGGCTCCT ATTCATACAC GCAGGTGGGC TCCAGCGGGG
1381CGGATGTGGA GAAGCTGGCC AAGCCCCTGC CGTACACGGA GAGCTCAAAG ACAGCGCCCA
1441TGCAGGTGCT GTTTTCCGGT GAGGCCACCC ACCGCAAGTA CTATTCCACC ACCCACGGTG
1501CTCTGCTGTC CGGCCAGCGT GAGGCTGCCC GCCTCATTGA GATGTACCGA GACCTCTTCC
1561AGCAGGGGAC CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA
1621ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT
1681CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTG TCCATAGCTT CTTATCGACT
1741GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t

Download FASTA (ORF) (Full)