Transcript: Mouse NM_001177938.1

Mus musculus ectodysplasin-A (Eda), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Eda (13607)
Length:
4946
CDS:
176..1342

Additional Resources:

NCBI RefSeq record:
NM_001177938.1
NBCI Gene record:
Eda (13607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362583 TAGGCGTGTTCGCCGCAATAA pLKO_005 628 CDS 100% 13.200 18.480 N Eda n/a
2 TRCN0000362584 TGCCATTAGGTTGCAACTTAA pLKO_005 1754 3UTR 100% 13.200 18.480 N Eda n/a
3 TRCN0000066198 CGCCGCAATAAGAGAAGCAAA pLKO.1 638 CDS 100% 4.950 6.930 N Eda n/a
4 TRCN0000066200 CCAACTACAACACTTGCTATA pLKO.1 1188 CDS 100% 10.800 8.640 N Eda n/a
5 TRCN0000066201 CCTAAGGTGTTTAAACTACAT pLKO.1 1007 CDS 100% 4.950 3.960 N Eda n/a
6 TRCN0000363273 ACGGCACCTACTTCATCTATA pLKO_005 1059 CDS 100% 13.200 9.240 N EDA n/a
7 TRCN0000362582 CTATGAACCCTAAGGTGTTTA pLKO_005 999 CDS 100% 13.200 9.240 N Eda n/a
8 TRCN0000363248 GACTGGTCTCGCATCACTATG pLKO_005 983 CDS 100% 10.800 7.560 N EDA n/a
9 TRCN0000066202 GACGGCACCTACTTCATCTAT pLKO.1 1058 CDS 100% 5.625 3.938 N Eda n/a
10 TRCN0000066199 GCACGCTGACATCTCTATCAA pLKO.1 1261 CDS 100% 5.625 3.938 N Eda n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00475 pDONR223 100% 90.7% 93.8% None (many diffs) n/a
2 ccsbBroad304_00475 pLX_304 0% 90.7% 93.8% V5 (many diffs) n/a
3 TRCN0000469272 GGAGTCGTGAAACAACACGTTTGC pLX_317 32.6% 90.7% 93.8% V5 (many diffs) n/a
Download CSV