Transcript: Human NM_001177970.2

Homo sapiens vitrin (VIT), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
VIT (5212)
Length:
2692
CDS:
286..2259

Additional Resources:

NCBI RefSeq record:
NM_001177970.2
NBCI Gene record:
VIT (5212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001177970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373854 CAACGGTGTCCAATCGTTATC pLKO_005 639 CDS 100% 10.800 15.120 N VIT n/a
2 TRCN0000373937 CCTATCAGAGGCCACCTATTC pLKO_005 788 CDS 100% 10.800 15.120 N VIT n/a
3 TRCN0000134980 CGTCTTAGAAAGTAAACCCAA pLKO.1 687 CDS 100% 2.640 3.696 N VIT n/a
4 TRCN0000373936 GAGAGTCAGGAATCAACATTT pLKO_005 1475 CDS 100% 13.200 9.240 N VIT n/a
5 TRCN0000135415 GCCCAACAAGAGGAAGTTAAT pLKO.1 1992 CDS 100% 13.200 9.240 N VIT n/a
6 TRCN0000135383 GTCTGGTTACAAAGGGAGTTA pLKO.1 615 CDS 100% 4.950 3.465 N VIT n/a
7 TRCN0000135658 GTTTGACAACCTCCATCAGTA pLKO.1 2181 CDS 100% 4.950 3.465 N VIT n/a
8 TRCN0000134423 GAGGAAGTTAATGATCCTCAT pLKO.1 2001 CDS 100% 0.405 0.284 N VIT n/a
9 TRCN0000135338 CAGCAAGTGCTGCTTTACTAA pLKO.1 2280 3UTR 100% 5.625 3.375 N VIT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06715 pDONR223 100% 99.7% 99.5% None (many diffs) n/a
2 ccsbBroad304_06715 pLX_304 0% 99.7% 99.5% V5 (many diffs) n/a
3 TRCN0000481324 AAAACTTCAATTTAGTTGCAGACC pLX_317 22.1% 99.7% 99.5% V5 (many diffs) n/a
Download CSV