Transcript: Human NM_001178092.2

Homo sapiens branched chain amino acid transaminase 1 (BCAT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BCAT1 (586)
Length:
9131
CDS:
170..1147

Additional Resources:

NCBI RefSeq record:
NM_001178092.2
NBCI Gene record:
BCAT1 (586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005908 GCTTTGCACTATGCAGTGGAA pLKO.1 356 CDS 100% 2.640 3.696 N BCAT1 n/a
2 TRCN0000434997 GATCAAGAATGGGTCCCATAT pLKO_005 428 CDS 100% 10.800 8.640 N BCAT1 n/a
3 TRCN0000415763 GAGCCCAGTGGGACCTTATTT pLKO_005 547 CDS 100% 15.000 10.500 N BCAT1 n/a
4 TRCN0000416315 CATTAATGTAAGCCATATAAC pLKO_005 1381 3UTR 100% 13.200 9.240 N BCAT1 n/a
5 TRCN0000005906 CCATTCTTCAAGACTTAGTTA pLKO.1 3660 3UTR 100% 5.625 3.938 N BCAT1 n/a
6 TRCN0000005907 CCCAATGTGAAGCAGTAGATA pLKO.1 684 CDS 100% 5.625 3.938 N BCAT1 n/a
7 TRCN0000010976 CCTGTGTTGTTTGCCCAGTTT pLKO.1 987 CDS 100% 4.950 2.970 N BCAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10694 pDONR223 100% 64.7% 62.5% None (many diffs) n/a
2 ccsbBroad304_10694 pLX_304 0% 64.7% 62.5% V5 (many diffs) n/a
3 TRCN0000469378 ATCGTGTGTTGTTGCAGTTCGAGC pLX_317 36.1% 64.7% 62.5% V5 (many diffs) n/a
Download CSV