Transcript: Human NM_001178117.1

Homo sapiens multiple inositol-polyphosphate phosphatase 1 (MINPP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
MINPP1 (9562)
Length:
2674
CDS:
451..1389

Additional Resources:

NCBI RefSeq record:
NM_001178117.1
NBCI Gene record:
MINPP1 (9562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001178117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052745 CCGAGTGCAGATGTTATTAAA pLKO.1 1514 3UTR 100% 15.000 21.000 N MINPP1 n/a
2 TRCN0000301004 CCGAGTGCAGATGTTATTAAA pLKO_005 1514 3UTR 100% 15.000 21.000 N MINPP1 n/a
3 TRCN0000380160 GCTTGTAATAGGTAGGCAATT pLKO_005 1735 3UTR 100% 10.800 15.120 N MINPP1 n/a
4 TRCN0000052746 CCTCCAACAGTTAATGATAAA pLKO.1 1102 CDS 100% 13.200 9.240 N MINPP1 n/a
5 TRCN0000301001 CCTCCAACAGTTAATGATAAA pLKO_005 1102 CDS 100% 13.200 9.240 N MINPP1 n/a
6 TRCN0000379453 GGTAGGACAGCTCTAGCATTT pLKO_005 2107 3UTR 100% 10.800 7.560 N MINPP1 n/a
7 TRCN0000052744 CCTTTGGCTTACTCACAAGAA pLKO.1 1548 3UTR 100% 4.950 3.465 N MINPP1 n/a
8 TRCN0000301002 CCTTTGGCTTACTCACAAGAA pLKO_005 1548 3UTR 100% 4.950 3.465 N MINPP1 n/a
9 TRCN0000052747 GACCAGAAATGCAGAACATTT pLKO.1 1214 CDS 100% 1.320 0.924 N MINPP1 n/a
10 TRCN0000301077 GACCAGAAATGCAGAACATTT pLKO_005 1214 CDS 100% 1.320 0.924 N MINPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02199 pDONR223 100% 64% 57.1% None 833_834ins232;936_937ins293 n/a
2 ccsbBroad304_02199 pLX_304 0% 64% 57.1% V5 833_834ins232;936_937ins293 n/a
3 TRCN0000469873 TAAATGCTCGACTCGTTCTGCCGA pLX_317 25.3% 64% 57.1% V5 833_834ins232;936_937ins293 n/a
Download CSV