Transcript: Human NM_001184875.2

Homo sapiens G protein-coupled receptor associated sorting protein 2 (GPRASP2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
GPRASP2 (114928)
Length:
3858
CDS:
985..3501

Additional Resources:

NCBI RefSeq record:
NM_001184875.2
NBCI Gene record:
GPRASP2 (114928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413416 TCAGTCTTGAGCCGCTTATTT pLKO_005 3392 CDS 100% 15.000 7.500 Y GPRASP2 n/a
2 TRCN0000422342 TCTGAAGAAGAGGCCATATTT pLKO_005 2311 CDS 100% 15.000 7.500 Y GPRASP2 n/a
3 TRCN0000062873 GCTGTCCAGATTGCGGTATTT pLKO.1 3706 3UTR 100% 13.200 6.600 Y GPRASP2 n/a
4 TRCN0000416579 GTAGGTGGCGCTCGTTCTAAA pLKO_005 1297 CDS 100% 13.200 6.600 Y GPRASP2 n/a
5 TRCN0000222084 GAGTCTGAAGATGAGTTCTAT pLKO.1 1969 CDS 100% 5.625 2.813 Y GPRASP2 n/a
6 TRCN0000222082 CCCTTGCACATAGTGTGGATT pLKO.1 3041 CDS 100% 4.950 2.475 Y GPRASP2 n/a
7 TRCN0000222083 CCTCACTATGACTATTGACTA pLKO.1 3099 CDS 100% 4.950 2.475 Y GPRASP2 n/a
8 TRCN0000222085 GCGAGAACGAAGTTTCACGTT pLKO.1 3178 CDS 100% 2.640 1.320 Y GPRASP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04669 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04669 pLX_304 0% 100% 100% V5 n/a
Download CSV