Transcript: Human NM_001185177.2

Homo sapiens carboxylesterase 3 (CES3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CES3 (23491)
Length:
3849
CDS:
43..1749

Additional Resources:

NCBI RefSeq record:
NM_001185177.2
NBCI Gene record:
CES3 (23491)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001185177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046715 GACCGCCTTGTGAATGTCTTT pLKO.1 202 CDS 100% 4.950 6.930 N CES3 n/a
2 TRCN0000046716 GCAGATTTGTCCTCAACGGAA pLKO.1 362 CDS 100% 2.640 3.696 N CES3 n/a
3 TRCN0000377702 ATTCAACCAGGCGGAACAATA pLKO_005 1590 CDS 100% 13.200 9.240 N CES3 n/a
4 TRCN0000046713 GCCCACCGTCATAGATGAATA pLKO.1 1206 CDS 100% 13.200 9.240 N CES3 n/a
5 TRCN0000371772 GCCTGGTCCTCAACGTCTATA pLKO_005 413 CDS 100% 13.200 9.240 N CES3 n/a
6 TRCN0000046714 CCTGGATACAATGGAGCAGAT pLKO.1 1116 CDS 100% 4.050 2.835 N CES3 n/a
7 TRCN0000046717 GATACAACAGTGGCACCAGAA pLKO.1 1695 CDS 100% 4.050 2.835 N CES3 n/a
8 TRCN0000371719 TTCAAGATACCTTCGAGATTC pLKO_005 1317 CDS 100% 10.800 6.480 N CES3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001185177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02780 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02780 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477455 AACATGTCTGCTTTTGGTTACTTA pLX_317 24.8% 100% 100% V5 n/a
Download CSV