Transcript: Human NM_001190349.2

Homo sapiens dermokine (DMKN), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DMKN (93099)
Length:
1401
CDS:
175..1284

Additional Resources:

NCBI RefSeq record:
NM_001190349.2
NBCI Gene record:
DMKN (93099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140147 GAAGATGTCATTCGACACGGA pLKO.1 526 CDS 100% 0.660 0.924 N DMKN n/a
2 TRCN0000443689 GAAACACTGGGCACGAGATTG pLKO_005 494 CDS 100% 10.800 7.560 N DMKN n/a
3 TRCN0000438594 TGAGAGCCAGCAACCAGAATG pLKO_005 833 CDS 100% 10.800 7.560 N DMKN n/a
4 TRCN0000140170 GCAGGCAGCTTTGGAATGAAT pLKO.1 715 CDS 100% 5.625 3.938 N DMKN n/a
5 TRCN0000122463 GCCACAATGGTGCTTGGGAAA pLKO.1 584 CDS 100% 4.050 2.835 N DMKN n/a
6 TRCN0000145590 CTTTGACACTTTCTGGAAGAA pLKO.1 1191 CDS 100% 4.950 2.970 N DMKN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14344 pDONR223 100% 76.4% 75.4% None (many diffs) n/a
2 ccsbBroad304_14344 pLX_304 0% 76.4% 75.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472993 CGTTCACGTTGTCCTAATTAACGG pLX_317 24.7% 76.4% 75.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV