Construct: ORF TRCN0000472993
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007988.1_s317c1
- Derived from:
- ccsbBroadEn_14344
- DNA Barcode:
- CGTTCACGTTGTCCTAATTAACGG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DMKN (93099)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472993
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93099 | DMKN | dermokine | NM_033317.5 | 99.7% | 99.1% | 272T>C;1280A>C;1419delG |
| 2 | human | 93099 | DMKN | dermokine | XM_011527507.2 | 90.9% | 89.2% | (many diffs) |
| 3 | human | 93099 | DMKN | dermokine | XM_011527506.2 | 90.6% | 90% | (many diffs) |
| 4 | human | 93099 | DMKN | dermokine | XM_011527509.2 | 89.8% | 89.2% | (many diffs) |
| 5 | human | 93099 | DMKN | dermokine | XM_024451775.1 | 89.8% | 89.2% | (many diffs) |
| 6 | human | 93099 | DMKN | dermokine | XM_011527504.2 | 88.5% | 88% | (many diffs) |
| 7 | human | 93099 | DMKN | dermokine | XM_011527505.2 | 88.3% | 86.6% | (many diffs) |
| 8 | human | 93099 | DMKN | dermokine | XM_011527503.2 | 87.5% | 86.9% | (many diffs) |
| 9 | human | 93099 | DMKN | dermokine | XM_011527508.2 | 87.3% | 86.7% | (many diffs) |
| 10 | human | 93099 | DMKN | dermokine | XM_011527502.2 | 87.2% | 86.6% | (many diffs) |
| 11 | human | 93099 | DMKN | dermokine | XM_011527501.2 | 85.6% | 85% | (many diffs) |
| 12 | human | 93099 | DMKN | dermokine | XM_011527500.2 | 85.2% | 84.7% | (many diffs) |
| 13 | human | 93099 | DMKN | dermokine | XM_011527499.2 | 84.8% | 84.2% | (many diffs) |
| 14 | human | 93099 | DMKN | dermokine | XM_011527497.2 | 84.6% | 84.1% | (many diffs) |
| 15 | human | 93099 | DMKN | dermokine | XM_011527498.2 | 84.6% | 84.1% | (many diffs) |
| 16 | human | 93099 | DMKN | dermokine | XM_011527496.2 | 84.3% | 83.7% | (many diffs) |
| 17 | human | 93099 | DMKN | dermokine | XM_011527494.2 | 82.5% | 81.9% | (many diffs) |
| 18 | human | 93099 | DMKN | dermokine | XM_011527495.2 | 82.5% | 81.9% | (many diffs) |
| 19 | human | 93099 | DMKN | dermokine | NM_001190347.2 | 81.1% | 80.5% | (many diffs) |
| 20 | human | 93099 | DMKN | dermokine | NM_001126058.3 | 80% | 78.9% | (many diffs) |
| 21 | human | 93099 | DMKN | dermokine | NM_001126056.3 | 78.7% | 78.1% | (many diffs) |
| 22 | human | 93099 | DMKN | dermokine | NM_001126057.3 | 78% | 77% | (many diffs) |
| 23 | human | 93099 | DMKN | dermokine | NM_001190349.2 | 76.4% | 75.4% | (many diffs) |
| 24 | human | 93099 | DMKN | dermokine | NM_001190348.2 | 72.4% | 71.5% | (many diffs) |
| 25 | human | 93099 | DMKN | dermokine | XR_935874.2 | 62.5% | (many diffs) | |
| 26 | human | 93099 | DMKN | dermokine | XR_935873.2 | 60.6% | (many diffs) | |
| 27 | human | 93099 | DMKN | dermokine | XR_935872.2 | 59.5% | (many diffs) | |
| 28 | human | 93099 | DMKN | dermokine | XR_935871.2 | 58.6% | (many diffs) | |
| 29 | human | 93099 | DMKN | dermokine | XR_002958384.1 | 46.8% | (many diffs) | |
| 30 | human | 93099 | DMKN | dermokine | XR_002958383.1 | 46% | (many diffs) | |
| 31 | human | 93099 | DMKN | dermokine | NM_001126059.4 | 38.1% | 35.9% | (many diffs) |
| 32 | human | 93099 | DMKN | dermokine | XM_024451776.1 | 37.2% | 35% | (many diffs) |
| 33 | human | 93099 | DMKN | dermokine | NM_001308380.2 | 37% | 34.8% | (many diffs) |
| 34 | human | 93099 | DMKN | dermokine | XM_017027475.1 | 35.7% | 33.6% | (many diffs) |
| 35 | human | 93099 | DMKN | dermokine | XM_006723484.1 | 35.6% | 33.5% | (many diffs) |
| 36 | human | 93099 | DMKN | dermokine | XM_011527513.1 | 35.2% | 31.9% | (many diffs) |
| 37 | human | 93099 | DMKN | dermokine | NM_001308383.2 | 34.5% | 32.3% | (many diffs) |
| 38 | human | 93099 | DMKN | dermokine | XM_006723477.1 | 33.6% | 31.6% | (many diffs) |
| 39 | human | 93099 | DMKN | dermokine | NM_001352328.2 | 33.6% | 31.4% | (many diffs) |
| 40 | human | 93099 | DMKN | dermokine | XM_006723489.1 | 31.2% | 29.1% | (many diffs) |
| 41 | human | 93099 | DMKN | dermokine | XM_006723503.3 | 31.2% | 29.1% | (many diffs) |
| 42 | human | 93099 | DMKN | dermokine | XM_006723493.2 | 30.9% | 28.7% | (many diffs) |
| 43 | human | 93099 | DMKN | dermokine | NR_033746.2 | 30.7% | (many diffs) | |
| 44 | human | 93099 | DMKN | dermokine | NR_147959.2 | 30.4% | (many diffs) | |
| 45 | human | 93099 | DMKN | dermokine | XM_024451777.1 | 27.3% | 26.6% | (many diffs) |
| 46 | human | 93099 | DMKN | dermokine | XM_006723494.2 | 26.5% | 25.9% | (many diffs) |
| 47 | human | 93099 | DMKN | dermokine | NM_001352329.2 | 25.7% | 25.2% | 0_1ins1059;221A>C;360delG |
| 48 | human | 93099 | DMKN | dermokine | NM_001352330.2 | 25.7% | 25.2% | 0_1ins1059;221A>C;360delG |
| 49 | human | 93099 | DMKN | dermokine | XM_024451778.1 | 25.7% | 25.2% | 0_1ins1059;221A>C;360delG |
| 50 | human | 93099 | DMKN | dermokine | XM_024451779.1 | 25.7% | 25.2% | 0_1ins1059;221A>C;360delG |
| 51 | human | 93099 | DMKN | dermokine | NM_001352331.2 | 18.6% | 16.2% | (many diffs) |
| 52 | human | 93099 | DMKN | dermokine | NM_001035516.4 | 16.8% | 14% | (many diffs) |
| 53 | human | 93099 | DMKN | dermokine | NM_001352332.2 | 15% | 12.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1494
- ORF length:
- 1428
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gttccagggg cccctggcct gcctcctgct ggccctctgc ctgggcagtg 121 gggaggctgg ccccctgcag agcggagagg aaagcactgg gacaaatatt ggggaggccc 181 ttggacatgg cctgggagac gccctgagcg aaggggtggg aaaggccatt ggcaaagagg 241 ccggaggggc agctggctct aaagtcagtg aggcccttgg ccaagggacc agagaagcag 301 ttggcactgg agtcaggcag gttccaggct ttggcgcagc agatgctttg ggcaacaggg 361 tcggggaagc agcccatgct ctgggaaaca ctgggcacga gattggcaga caggcagaag 421 atgtcattcg acacggagca gatgctgtcc gcggctcctg gcagggggtg cctggccaca 481 atggtgcttg ggaaacttct ggaggccatg gcatctttgg ctctcaaggt ggccttggag 541 gccagggcca gggcaatcct ggaggtctgg ggactccgtg ggtccacgga taccccggaa 601 actcagcagg cagctttgga atgaatcctc agggagctcc ctggggtcaa ggaggcaatg 661 gagggccacc aaactttggg accaacactc agggagctgt ggcccagcct ggctatggtt 721 cagtgagagc cagcaaccag aatgaagggt gcacgaatcc cccaccatct ggctcaggtg 781 gaggctccag caactctggg ggaggcagcg gctcacagtc gggcagcagt ggcagtggca 841 gcaatggtga caacaacaat ggcagcagca gtggtggcag cagcagtggc agcagcagtg 901 gcggcagcag tggcggcagc agtggtggca gcagtggcaa cagtggtggc agcagaggtg 961 acagcggcag tgagtcctcc tggggatcca gcaccggctc ctcctccggc aaccacggtg 1021 ggagcggcgg aggaaatgga cataaacccg ggtgtgaaaa gccagggaat gaagcccgcg 1081 ggagcgggga atctgggatt cagaactctg agacgtctcc tgggatgttt aactttgaca 1141 ctttcTGGAA GAATTTTAAA TCCAAGCTGG GTTTCATCAA CTGGGATGCC ATAAACAAGA 1201 ACCAGGTCCC GCCCCCCAGC ACCCGAGCCC TCCTCTACTT CAGCCGACTC TGGGAGGATT 1261 TCAAACAGAA CACTCCTTTC CTCAACTGGA AAGCAATTAT TGAGGGTGCG GACGCGTCAT 1321 CACTGCAGAA ACGTGCAGGC AGAGCCGATC AGAACTACAA TTACAACCAG CATGCGTATC 1381 CCACTGCCTA TGGTGGGAAG TACTCAGTCA AGACCCCTGC AAAGGGGGGA GTCTCACCTT 1441 CTTCCTCGGC TTCCCGGGTG CAACCTGGCC TGCTGCAGTG GGTAAGTTTT GGTACCCAAC 1501 TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA 1561 TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT 1621 ATCTTGTGGA AAGGACGACG TTCACGTTGT CCTAATTAAC GGACGCGTTA AGTCgacaat 1681 caacctctgg attacaaaat ttgtgaaaga tt