Transcript: Mouse NM_001190374.1

Mus musculus ADAMTS-like 3 (Adamtsl3), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Adamtsl3 (269959)
Length:
7285
CDS:
215..5335

Additional Resources:

NCBI RefSeq record:
NM_001190374.1
NBCI Gene record:
Adamtsl3 (269959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092445 GCGCCAGATGTGGAATAACAA pLKO.1 3352 CDS 100% 5.625 7.875 N Adamtsl3 n/a
2 TRCN0000092443 CCCAAATAAGTGGTCCTGTTT pLKO.1 6602 3UTR 100% 4.950 6.930 N Adamtsl3 n/a
3 TRCN0000092444 GCCTAATGTAACTTGGTTGAA pLKO.1 4240 CDS 100% 4.950 6.930 N Adamtsl3 n/a
4 TRCN0000087401 TGTGAGGGAGACTCCTATGAT pLKO.1 220 CDS 100% 5.625 3.938 N Adamtsl3 n/a
5 TRCN0000092446 CGGACACAACTCACTACTGTA pLKO.1 5238 CDS 100% 4.950 3.465 N Adamtsl3 n/a
6 TRCN0000087402 GCTATGATGACCAGACTTCAA pLKO.1 426 CDS 100% 4.950 3.465 N Adamtsl3 n/a
7 TRCN0000087398 CCTCCTATTCTTTGCGGAGAT pLKO.1 534 CDS 100% 4.050 2.835 N Adamtsl3 n/a
8 TRCN0000087399 GCCTACTTCCTTCCTGAGTTT pLKO.1 344 CDS 100% 4.950 2.970 N Adamtsl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.