Transcript: Mouse NM_001190483.2

Mus musculus proprotein convertase subtilisin/kexin type 5 (Pcsk5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pcsk5 (18552)
Length:
7193
CDS:
481..6114

Additional Resources:

NCBI RefSeq record:
NM_001190483.2
NBCI Gene record:
Pcsk5 (18552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190483.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222011 GCGGGACATTTGAACGCTAAT pLKO.1 1747 CDS 100% 10.800 15.120 N Pcsk5 n/a
2 TRCN0000222013 CCTCGTTATGATGCAAGCAAT pLKO.1 1090 CDS 100% 4.950 6.930 N Pcsk5 n/a
3 TRCN0000222012 CCGGAGCAGATGGATGTATTA pLKO.1 2870 CDS 100% 13.200 9.240 N Pcsk5 n/a
4 TRCN0000222014 GCCTGACTTCTTTCTATACAA pLKO.1 4590 CDS 100% 5.625 3.938 N Pcsk5 n/a
5 TRCN0000222015 GCCACTACACTTGTCAAGGAT pLKO.1 3290 CDS 100% 3.000 2.100 N Pcsk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190483.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06697 pDONR223 100% 42.7% 44% None (many diffs) n/a
2 ccsbBroad304_06697 pLX_304 0% 42.7% 44% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468891 TGGTCCTTATAGGCAGCTTCCTAG pLX_317 .7% 42.7% 44% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV