Transcript: Human NM_001193289.1

Homo sapiens APOBEC3A and APOBEC3B deletion hybrid (APOBEC3A_B), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
APOBEC3A_B (100913187)
Length:
1103
CDS:
171..770

Additional Resources:

NCBI RefSeq record:
NM_001193289.1
NBCI Gene record:
APOBEC3A_B (100913187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049962 ACACATATTCACTTCCAACTT pLKO.1 215 CDS 100% 4.950 2.475 Y APOBEC3A n/a
2 TRCN0000419754 CAATGGCACCTCGGTCAAGAT pLKO_005 293 CDS 100% 4.950 2.475 Y APOBEC3A n/a
3 TRCN0000049960 CACTTGATGGATCCACACATA pLKO.1 201 CDS 100% 4.950 2.475 Y APOBEC3A n/a
4 TRCN0000139812 CCTGGTTCCTTCTTTGCAGTT pLKO.1 401 CDS 100% 4.050 2.025 Y APOBEC3B n/a
5 TRCN0000140546 GCAAAGCAATGTGCTCCTGAT pLKO.1 891 3UTR 100% 4.050 2.025 Y APOBEC3B n/a
6 TRCN0000049959 ACTTTAACAATGGCATTGGAA pLKO.1 232 CDS 100% 3.000 1.500 Y APOBEC3A n/a
7 TRCN0000049961 ACGATGAATTTAAGCACTGCT pLKO.1 634 CDS 100% 2.640 1.320 Y APOBEC3A n/a
8 TRCN0000140051 CCAAGTCTCCATCATGACCTA pLKO.1 614 CDS 100% 2.640 1.320 Y APOBEC3B n/a
9 TRCN0000049958 GCTTTCTACACAACCAGGCTA pLKO.1 328 CDS 100% 2.640 1.320 Y APOBEC3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05186 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05186 pLX_304 0% 100% 100% V5 n/a
Download CSV