Transcript: Mouse NM_001193305.1

Mus musculus microtubule associated monooxygenase, calponin and LIM domain containing 2 (Mical2), transcript variant A, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mical2 (320878)
Length:
3680
CDS:
336..3644

Additional Resources:

NCBI RefSeq record:
NM_001193305.1
NBCI Gene record:
Mical2 (320878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001193305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217310 GACTGCGATGAAGGCAAATTT pLKO.1 3399 CDS 100% 15.000 10.500 N Mical2 n/a
2 TRCN0000257045 GACTGCGATGAAGGCAAATTT pLKO_005 3399 CDS 100% 15.000 10.500 N MICAL2 n/a
3 TRCN0000215820 CAAGAAGTTCTATGGGAAATT pLKO.1 761 CDS 100% 13.200 9.240 N Mical2 n/a
4 TRCN0000192979 GATCAACTTTGACTCGCTGAA pLKO.1 2021 CDS 100% 4.050 2.835 N Mical2 n/a
5 TRCN0000278704 GATCAACTTTGACTCGCTGAA pLKO_005 2021 CDS 100% 4.050 2.835 N Mical2 n/a
6 TRCN0000202269 GCTCCAGTCAAGAGTATGCTA pLKO.1 2428 CDS 100% 3.000 2.100 N Mical2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07456 pDONR223 100% 84.6% 86.2% None (many diffs) n/a
2 ccsbBroad304_07456 pLX_304 0% 84.6% 86.2% V5 (many diffs) n/a
3 TRCN0000471327 GGAACCAGACAGATTGGCCTCCAG pLX_317 11.7% 84.6% 86.2% V5 (many diffs) n/a
Download CSV