Transcript: Human NM_001193335.2

Homo sapiens asporin (ASPN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-06
Taxon:
Homo sapiens (human)
Gene:
ASPN (54829)
Length:
2234
CDS:
245..973

Additional Resources:

NCBI RefSeq record:
NM_001193335.2
NBCI Gene record:
ASPN (54829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371354 GTAATTGGTAATGTCCATTTA pLKO_005 1158 3UTR 100% 13.200 18.480 N ASPN n/a
2 TRCN0000094162 CCTGCAACATTTCGTTGTGTT pLKO.1 1089 3UTR 100% 4.950 6.930 N Aspn n/a
3 TRCN0000352033 CCTGCAACATTTCGTTGTGTT pLKO_005 1089 3UTR 100% 4.950 6.930 N Aspn n/a
4 TRCN0000371353 GGAATACTTGAACTCTATTAA pLKO_005 1206 3UTR 100% 15.000 10.500 N ASPN n/a
5 TRCN0000119167 GCCTTCAGTAAATGTTCATTA pLKO.1 1731 3UTR 100% 13.200 9.240 N ASPN n/a
6 TRCN0000094163 GCTCTGCCAAACCCTTCTTTA pLKO.1 282 CDS 100% 13.200 9.240 N Aspn n/a
7 TRCN0000352111 GCTCTGCCAAACCCTTCTTTA pLKO_005 282 CDS 100% 13.200 9.240 N Aspn n/a
8 TRCN0000119168 CCCGGTGAAATACTGGGAAAT pLKO.1 1064 3UTR 100% 10.800 7.560 N ASPN n/a
9 TRCN0000119171 CCAACCAACATTCCATTTGAT pLKO.1 530 CDS 100% 5.625 3.938 N ASPN n/a
10 TRCN0000119170 CCTCTTGATAATAATGGGATA pLKO.1 857 CDS 100% 4.050 2.835 N ASPN n/a
11 TRCN0000119169 CCCTCTTGATAATAATGGGAT pLKO.1 856 CDS 100% 2.640 1.848 N ASPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12093 pDONR223 100% 62.5% 61.7% None (many diffs) n/a
2 TRCN0000477769 TGAAGACTACGTACATCTATATAA pLX_317 37.7% 62.5% 61.7% V5 (many diffs) n/a
Download CSV