Transcript: Human NM_001193465.1

Homo sapiens KAT8 regulatory NSL complex subunit 1 (KANSL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
KANSL1 (284058)
Length:
5140
CDS:
258..3572

Additional Resources:

NCBI RefSeq record:
NM_001193465.1
NBCI Gene record:
KANSL1 (284058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364847 ACACCATGCCTCCCGAAATTC pLKO_005 2182 CDS 100% 13.200 18.480 N KANSL1 n/a
2 TRCN0000369822 CTCGTAAGGACAGGCACAAAT pLKO_005 2413 CDS 100% 13.200 18.480 N KANSL1 n/a
3 TRCN0000376443 ACTCACTAACTATTGGCATTA pLKO_005 3596 3UTR 100% 10.800 15.120 N KANSL1 n/a
4 TRCN0000364912 AGCAGGTTGAGAGGCATATAC pLKO_005 1189 CDS 100% 13.200 10.560 N KANSL1 n/a
5 TRCN0000364911 AGCCTAGATTTCCGAAATAAT pLKO_005 435 CDS 100% 15.000 10.500 N KANSL1 n/a
6 TRCN0000241470 CAAACAGATACGTGCTAATAA pLKO_005 1667 CDS 100% 15.000 10.500 N Kansl1 n/a
7 TRCN0000369878 CAAACAGATACGTGCTAATAA pLKO_005 1667 CDS 100% 15.000 10.500 N KANSL1 n/a
8 TRCN0000144004 CAGCCTAGATTTCCGAAATAA pLKO.1 434 CDS 100% 15.000 10.500 N KANSL1 n/a
9 TRCN0000241467 TTGGCTAAGAAATTGACTAAA pLKO_005 726 CDS 100% 13.200 9.240 N Kansl1 n/a
10 TRCN0000364923 TTGGCTAAGAAATTGACTAAA pLKO_005 726 CDS 100% 13.200 9.240 N KANSL1 n/a
11 TRCN0000369821 GTTCATCCTGTTCTAGCATTT pLKO_005 2250 CDS 100% 10.800 7.560 N KANSL1 n/a
12 TRCN0000143258 GCAGTGAACAGGCATTTGATT pLKO.1 1435 CDS 100% 5.625 3.938 N KANSL1 n/a
13 TRCN0000141459 CTCGCGTAGAGAAACTGCAAT pLKO.1 2878 CDS 100% 4.950 3.465 N KANSL1 n/a
14 TRCN0000122200 GAACAGGCATTTGATTCAGAT pLKO.1 1440 CDS 100% 4.950 3.465 N KANSL1 n/a
15 TRCN0000143210 GAGACCATTCATCTGAGAGAA pLKO.1 2623 CDS 100% 4.950 3.465 N KANSL1 n/a
16 TRCN0000144514 CTGCAATACAAGGAAATCCTT pLKO.1 2892 CDS 100% 3.000 2.100 N KANSL1 n/a
17 TRCN0000143462 GCAGTAGATTATCACCTGGTA pLKO.1 991 CDS 100% 2.640 1.848 N KANSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13512 pDONR223 100% 43.6% 43.2% None (many diffs) n/a
2 ccsbBroad304_13512 pLX_304 0% 43.6% 43.2% V5 (many diffs) n/a
3 TRCN0000481544 GTGAGCGAAACGACCTGGAATTAA pLX_317 34.3% 43.6% 43.2% V5 (many diffs) n/a
Download CSV