Transcript: Human NM_001193517.2

Homo sapiens charged multivesicular body protein 3 (CHMP3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CHMP3 (51652)
Length:
3018
CDS:
96..644

Additional Resources:

NCBI RefSeq record:
NM_001193517.2
NBCI Gene record:
CHMP3 (51652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382215 GAGTTGTTGACAGGCAAATAA pLKO_005 178 CDS 100% 15.000 7.500 Y CHMP3 n/a
2 TRCN0000381536 TAGATTGCCCTGTGCAGTAAA pLKO_005 1013 3UTR 100% 13.200 6.600 Y CHMP3 n/a
3 TRCN0000379649 TCGCAAAGGGATTGTTCTTAT pLKO_005 790 3UTR 100% 13.200 6.600 Y CHMP3 n/a
4 TRCN0000381532 TGATGAAGGCTGGGATCATAG pLKO_005 376 CDS 100% 10.800 5.400 Y CHMP3 n/a
5 TRCN0000148119 GTGAAACGATCTGTGAAAGAT pLKO.1 225 CDS 100% 5.625 2.813 Y CHMP3 n/a
6 TRCN0000280247 GTGAAACGATCTGTGAAAGAT pLKO_005 225 CDS 100% 5.625 2.813 Y CHMP3 n/a
7 TRCN0000180845 GCACCCAGTAAAGTGACTGAT pLKO.1 513 CDS 100% 4.950 2.475 Y CHMP3 n/a
8 TRCN0000098068 CCAAGGAGATGATCAGGTCAA pLKO.1 286 CDS 100% 4.050 2.025 Y Chmp3 n/a
9 TRCN0000318282 CCAAGGAGATGATCAGGTCAA pLKO_005 286 CDS 100% 4.050 2.025 Y Chmp3 n/a
10 TRCN0000150106 CAAAGTCTTGTGAAGATTCCA pLKO.1 318 CDS 100% 3.000 1.500 Y CHMP3 n/a
11 TRCN0000297794 CAAAGTCTTGTGAAGATTCCA pLKO_005 318 CDS 100% 3.000 1.500 Y CHMP3 n/a
12 TRCN0000149440 GATCAGGAAGAAATGGAGGAA pLKO.1 432 CDS 100% 2.640 1.320 Y CHMP3 n/a
13 TRCN0000297792 GATCAGGAAGAAATGGAGGAA pLKO_005 432 CDS 100% 2.640 1.320 Y CHMP3 n/a
14 TRCN0000146786 CAATGAGTGGTCATTGAAGAT pLKO.1 143 CDS 100% 0.495 0.248 Y CHMP3 n/a
15 TRCN0000280248 CAATGAGTGGTCATTGAAGAT pLKO_005 143 CDS 100% 0.495 0.248 Y CHMP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03356 pDONR223 100% 81.9% 81.9% None 212_213ins120 n/a
2 ccsbBroad304_03356 pLX_304 0% 81.9% 81.9% V5 212_213ins120 n/a
3 TRCN0000466056 GATTGTGGGACCCCCCCAGGACAG pLX_317 56.5% 81.9% 81.9% V5 212_213ins120 n/a
Download CSV