Transcript: Human NM_001194958.2

Homo sapiens potassium inwardly rectifying channel subfamily J member 18 (KCNJ18), mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
KCNJ18 (100134444)
Length:
2196
CDS:
371..1672

Additional Resources:

NCBI RefSeq record:
NM_001194958.2
NBCI Gene record:
KCNJ18 (100134444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001194958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434400 TCATCGACTCCTTCATGATTG pLKO_005 882 CDS 100% 10.800 5.400 Y KCNJ12 n/a
2 TRCN0000044519 GAACCAGTACAAGATTGACTA pLKO.1 1375 CDS 100% 4.950 2.475 Y KCNJ12 n/a
3 TRCN0000044522 TCGCACTTCCACAAGACCTAT pLKO.1 1397 CDS 100% 4.950 2.475 Y KCNJ12 n/a
4 TRCN0000437169 CATCGATGTGGGCTTCGACAA pLKO_005 1120 CDS 100% 4.050 2.025 Y KCNJ12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001194958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00896 pDONR223 100% 98.9% 98.6% None (many diffs) n/a
2 ccsbBroad304_00896 pLX_304 0% 98.9% 98.6% V5 (many diffs) n/a
3 TRCN0000481122 AACCCGACGGTCGGCATGCGTTCA pLX_317 24.9% 98.9% 98.6% V5 (many diffs) n/a
Download CSV