Transcript: Mouse NM_001195086.1

Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant A, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ppfia1 (233977)
Length:
5259
CDS:
212..4012

Additional Resources:

NCBI RefSeq record:
NM_001195086.1
NBCI Gene record:
Ppfia1 (233977)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251547 AGACGACAAGACGACGATAAA pLKO_005 2503 CDS 100% 13.200 18.480 N Ppfia1 n/a
2 TRCN0000251548 GACCAACTTGTCGTGACTATT pLKO_005 1775 CDS 100% 13.200 18.480 N Ppfia1 n/a
3 TRCN0000251546 TTGGACGAGACTTTCGATTTC pLKO_005 3653 CDS 100% 10.800 15.120 N Ppfia1 n/a
4 TRCN0000251544 ATGTATATCCAGGCTATAAAT pLKO_005 4245 3UTR 100% 15.000 10.500 N Ppfia1 n/a
5 TRCN0000342548 ATGTATATCCAGGCTATAAAT pLKO_005 4245 3UTR 100% 15.000 10.500 N PPFIA1 n/a
6 TRCN0000251545 TGGGCTCAGACTCTAGCATAT pLKO_005 3260 CDS 100% 10.800 7.560 N Ppfia1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07248 pDONR223 100% 81.3% 90.6% None (many diffs) n/a
2 ccsbBroad304_07248 pLX_304 0% 81.3% 90.6% V5 (many diffs) n/a
3 TRCN0000492109 GCCTACGAGACGTCTGAGGCGCCA pLX_317 9.8% 81.3% 90.6% V5 (many diffs) n/a
Download CSV