Transcript: Human NM_001195101.2

Homo sapiens protein tyrosine phosphatase 4A2 (PTP4A2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTP4A2 (8073)
Length:
3817
CDS:
976..1386

Additional Resources:

NCBI RefSeq record:
NM_001195101.2
NBCI Gene record:
PTP4A2 (8073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028999 CCTAATCAGATAGTAGATGAT pLKO.1 1102 CDS 100% 4.950 6.930 N Ptp4a2 n/a
2 TRCN0000002926 ATACCGACCTAAGATGCGATT pLKO.1 1326 CDS 100% 4.050 3.240 N PTP4A2 n/a
3 TRCN0000272545 ATACCGACCTAAGATGCGATT pLKO_005 1326 CDS 100% 4.050 3.240 N PTP4A2 n/a
4 TRCN0000350266 TTTCTGCCAGGATTGAATTAT pLKO_005 1647 3UTR 100% 15.000 10.500 N PTP4A2 n/a
5 TRCN0000002927 CAGATAGTAGATGATTGGTTA pLKO.1 1108 CDS 100% 4.950 3.465 N PTP4A2 n/a
6 TRCN0000272546 CAGATAGTAGATGATTGGTTA pLKO_005 1108 CDS 100% 4.950 3.465 N PTP4A2 n/a
7 TRCN0000002925 CCTGTAGAATTGTGGGCTGTA pLKO.1 2416 3UTR 100% 4.050 2.835 N PTP4A2 n/a
8 TRCN0000029003 CAGTGCATTGTGTTGCAGGAT pLKO.1 1175 CDS 100% 2.640 1.848 N Ptp4a2 n/a
9 TRCN0000002924 CTTCAGAGATACCAATGGGCA pLKO.1 1350 CDS 100% 0.660 0.462 N PTP4A2 n/a
10 TRCN0000272607 CTTCAGAGATACCAATGGGCA pLKO_005 1350 CDS 100% 0.660 0.462 N PTP4A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01859 pDONR223 100% 81.4% 81.4% None 96_97ins93 n/a
2 ccsbBroad304_01859 pLX_304 0% 81.4% 81.4% V5 96_97ins93 n/a
3 TRCN0000474197 TGACCAAGTCCCTTATTCCACGCC pLX_317 88.8% 81.4% 81.4% V5 96_97ins93 n/a
Download CSV