Transcript: Mouse NM_001195265.1

Mus musculus PDZ domain containing 7 (Pdzd7), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pdzd7 (100503041)
Length:
3927
CDS:
130..3195

Additional Resources:

NCBI RefSeq record:
NM_001195265.1
NBCI Gene record:
Pdzd7 (100503041)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112978 GCCTCTGACCTACGAGTTGTT pLKO.1 2989 CDS 100% 4.950 3.960 N Pdzd7 n/a
2 TRCN0000112977 CCCTCAAAGTATCCCTAAACT pLKO.1 3138 CDS 100% 5.625 3.938 N Pdzd7 n/a
3 TRCN0000112976 CCTCTGACCTACGAGTTGTTA pLKO.1 2990 CDS 100% 5.625 3.938 N Pdzd7 n/a
4 TRCN0000140413 GACGCTGATGAACCTCTTCTT pLKO.1 1524 CDS 100% 4.950 3.465 N PDZD7 n/a
5 TRCN0000112975 GCAACCCATGTCATGTGCATT pLKO.1 3360 3UTR 100% 4.950 3.465 N Pdzd7 n/a
6 TRCN0000141876 GCTGATGAACCTCTTCTTCAA pLKO.1 1527 CDS 100% 4.950 3.465 N PDZD7 n/a
7 TRCN0000139457 CAAGACGCTGATGAACCTCTT pLKO.1 1521 CDS 100% 4.050 2.835 N PDZD7 n/a
8 TRCN0000112979 AGGTCCCTCAAAGTATCCCTA pLKO.1 3134 CDS 100% 2.640 1.848 N Pdzd7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14276 pDONR223 100% 43.2% 45.8% None (many diffs) n/a
2 ccsbBroad304_14276 pLX_304 0% 43.2% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479509 CTTACGGTTTCCACAAAGGTCACC pLX_317 17.6% 43.2% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV