Transcript: Mouse NM_001195284.1

Mus musculus fibronectin type III and SPRY domain containing 1-like (Fsd1l), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fsd1l (319636)
Length:
7491
CDS:
128..1621

Additional Resources:

NCBI RefSeq record:
NM_001195284.1
NBCI Gene record:
Fsd1l (319636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248853 CAACAAGGTCATTAGATATTA pLKO_005 429 CDS 100% 15.000 21.000 N Fsd1l n/a
2 TRCN0000248849 TGATAGCTTGTACTCTATATT pLKO_005 280 CDS 100% 15.000 21.000 N Fsd1l n/a
3 TRCN0000248850 TCATTTCAACTCTGGCAAATA pLKO_005 159 CDS 100% 13.200 10.560 N Fsd1l n/a
4 TRCN0000248852 GAACTTCATTGATACACTAAA pLKO_005 196 CDS 100% 13.200 9.240 N Fsd1l n/a
5 TRCN0000155866 CCAAGTGCTGTGAGAACACTT pLKO.1 1541 CDS 100% 0.495 0.347 N FSD1L n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5419 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12756 pDONR223 100% 56% 59.4% None (many diffs) n/a
2 ccsbBroad304_12756 pLX_304 0% 56% 59.4% V5 (many diffs) n/a
3 TRCN0000468566 TCTATTTTATTCCGACCATGGTTT pLX_317 49.8% 56% 59.4% V5 (many diffs) n/a
Download CSV