Construct: ORF TRCN0000468566
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000314.1_s317c1
- Derived from:
- ccsbBroadEn_12756
- DNA Barcode:
- TCTATTTTATTCCGACCATGGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FSD1L (83856)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468566
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_011519081.2 | 100% | 100% | |
| 2 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_011519080.2 | 96.5% | 96.5% | 367_399del |
| 3 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_024447690.1 | 83.3% | 83.3% | 1_186del |
| 4 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_005252260.3 | 80.9% | 80.9% | 1_186del;553_585del |
| 5 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_017015184.1 | 80.9% | 80.9% | 1_186del;553_585del |
| 6 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_017015183.1 | 62.4% | 62.4% | 1_561del |
| 7 | human | 83856 | FSD1L | fibronectin type III and SP... | NM_001287192.2 | 62.2% | 62.2% | 1_561del;927_928insAGA |
| 8 | human | 83856 | FSD1L | fibronectin type III and SP... | NM_001287191.1 | 61.2% | 61% | 1_561del;930_959del |
| 9 | human | 83856 | FSD1L | fibronectin type III and SP... | NM_001330739.2 | 61.1% | 61.1% | 1_561del;928_960del |
| 10 | human | 83856 | FSD1L | fibronectin type III and SP... | NM_001145313.3 | 58.6% | 58.6% | 1_657del |
| 11 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_017015182.1 | 58.4% | 58.4% | 1_657del;1023_1024insAGA |
| 12 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_005252254.2 | 57.4% | 57.4% | 1_657del;1024_1056del |
| 13 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_011519078.2 | 57.2% | 57.2% | 1_696del |
| 14 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_011519079.2 | 57% | 57% | 1_696del;1062_1063insAGA |
| 15 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_011519077.2 | 56.8% | 56.8% | 1_675del;1042_1074del |
| 16 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_017015187.1 | 25% | 24.8% | (many diffs) |
| 17 | human | 83856 | FSD1L | fibronectin type III and SP... | XM_017015185.1 | 23% | 22.8% | (many diffs) |
| 18 | mouse | 319636 | Fsd1l | fibronectin type III and SP... | XM_006537982.1 | 72.6% | 77% | (many diffs) |
| 19 | mouse | 319636 | Fsd1l | fibronectin type III and SP... | XM_017320255.1 | 65.4% | 69.4% | (many diffs) |
| 20 | mouse | 319636 | Fsd1l | fibronectin type III and SP... | NM_001195284.1 | 56% | 59.4% | (many diffs) |
| 21 | mouse | 319636 | Fsd1l | fibronectin type III and SP... | XM_006537981.3 | 55.8% | 59.2% | (many diffs) |
| 22 | mouse | 319636 | Fsd1l | fibronectin type III and SP... | XM_006537980.3 | 54.8% | 58.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 999
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agaagaagat aataagattg accattttat actggaacat aggaagacta 121 attttgatgg acttccacgt gtaaaggatg agcgatgctg ggagataatt gataatatta 181 agggtactga atatacacta tcaggcttaa aatttgattc aaagtatatg aatttcagag 241 tgcgagcttg taacaaggct gtggctggag agtattctga tccagtgact ctagagacca 301 aagcacttaa cttcaatttg gataactcct catcccattt gaacctgaaa gttgaagata 361 catgtgtaga gtgggatcct actggaggaa aaggtcaaga aagtaaaatt aaaggaaaag 421 agaacaaggg cagaagtggt acaccatccc caaaacgaac atctgtaggc tccaggccac 481 cagcagtaag aggcagtaga gatcgtttta ctggagaatc atacacagtg ctggGAGACA 541 CTGCTATTGA AAGTGGACAA CATTATTGGG AGGTCAAGGC CCAGAAGGAT TGTAAATCCT 601 ACAGTGTGGG AGTAGCATAC AAAACGTTGG GGAAATTTGA CCAATTGGGA AAGACAAACA 661 CTAGTTGGTG TATCCATGTC AACAACTGGC TACAAAACAC ATTTGCAGCA AAGCATAATA 721 ATAAAGTCAA AGCTTTGGAT GTTACTGTTC CTGAAAAAAT AGGTGTATTT TGTGATTTTG 781 ATGGGGGTCA ACTTTCATTC TATGATGCAA ATTCTAAACA GTTGCTATAT TCCTTTAAGA 841 CAAAATTTAC TCAGCCAGTA CTACCTGGTT TCATGGTATG GTGTGGTGGA CTTTCTTTGA 901 GTACTGGGAT GCAGGTTCCA AGTGCTGTGA GAACACTTCA GAAAAGTGAA AATGGAATGA 961 CTGGTTCAGC TAGCAGCCTG AACAATGTTG TTACTCAATA CCCAACTTTC TTGTACAAAG 1021 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1081 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1141 ACGATCTATT TTATTCCGAC CATGGTTTAC GCGTTAAGTC gacaatcaac ctctggatta 1201 caaaatttgt gaaagatt