Transcript: Human NM_001195446.1

Homo sapiens serine and arginine rich splicing factor 7 (SRSF7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
SRSF7 (6432)
Length:
2453
CDS:
239..919

Additional Resources:

NCBI RefSeq record:
NM_001195446.1
NBCI Gene record:
SRSF7 (6432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001142 GAACTGTATGGATTGCGAGAA pLKO.1 351 CDS 100% 4.050 5.670 N SRSF7 n/a
2 TRCN0000273460 GAACTGTATGGATTGCGAGAA pLKO_005 351 CDS 100% 4.050 5.670 N SRSF7 n/a
3 TRCN0000001140 CGCTAGTATGTTGGAAGTTAT pLKO.1 2269 3UTR 100% 13.200 10.560 N SRSF7 n/a
4 TRCN0000273401 GATCAAGATCCAGGTCTATTT pLKO_005 828 CDS 100% 13.200 9.240 N SRSF7 n/a
5 TRCN0000273403 AGATCCTTAAGTTAGCTAATC pLKO_005 1409 3UTR 100% 10.800 7.560 N SRSF7 n/a
6 TRCN0000273400 CCTCGACGATCAAGATCTATC pLKO_005 716 CDS 100% 10.800 7.560 N SRSF7 n/a
7 TRCN0000273402 GTCACGGTCTAGATCACATTC pLKO_005 625 CDS 100% 10.800 7.560 N SRSF7 n/a
8 TRCN0000001143 AGGACTGGATGGAAAGGTGAT pLKO.1 433 CDS 100% 4.050 2.835 N SRSF7 n/a
9 TRCN0000001141 GATGCTATGAGTGTGGCGAAA pLKO.1 552 CDS 100% 4.050 2.835 N SRSF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01525 pDONR223 100% 94.9% 94.9% None 624_625ins36 n/a
2 ccsbBroad304_01525 pLX_304 0% 94.9% 94.9% V5 624_625ins36 n/a
3 TRCN0000467489 GCCCAGCAACTTAAATCGTCGGAT pLX_317 50.4% 94.9% 94.9% V5 624_625ins36 n/a
Download CSV