Construct: ORF TRCN0000467489
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015584.1_s317c1
- Derived from:
- ccsbBroadEn_01525
- DNA Barcode:
- GCCCAGCAACTTAAATCGTCGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRSF7 (6432)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467489
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6432 | SRSF7 | serine and arginine rich sp... | NM_001031684.3 | 100% | 100% | |
| 2 | human | 6432 | SRSF7 | serine and arginine rich sp... | NM_001363802.1 | 98.7% | 98.7% | 563_564insGTATTTCCA |
| 3 | human | 6432 | SRSF7 | serine and arginine rich sp... | NM_001195446.1 | 94.9% | 94.9% | 624_625ins36 |
| 4 | human | 6432 | SRSF7 | serine and arginine rich sp... | XM_005264485.2 | 93.6% | 93.6% | 563_564insGTATTTCCA;615_616ins36 |
| 5 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_001738892.1 | 57.9% | (many diffs) | |
| 6 | human | 6432 | SRSF7 | serine and arginine rich sp... | XM_011533032.2 | 49.5% | 47.4% | (many diffs) |
| 7 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_939711.1 | 44.8% | (many diffs) | |
| 8 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_001738894.1 | 44.2% | (many diffs) | |
| 9 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_939708.1 | 40.6% | 1_105del;490_1182del;1513_1755del | |
| 10 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_939709.1 | 40.1% | (many diffs) | |
| 11 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_939710.1 | 38.6% | (many diffs) | |
| 12 | human | 6432 | SRSF7 | serine and arginine rich sp... | XR_001738893.1 | 38.1% | (many diffs) | |
| 13 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | NM_146083.2 | 92.2% | 98.3% | (many diffs) |
| 14 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | NM_001195485.1 | 91% | 97% | (many diffs) |
| 15 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | NM_001195486.1 | 87.8% | 94.1% | (many diffs) |
| 16 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | XM_006524190.2 | 87.5% | 93.2% | (many diffs) |
| 17 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | NM_001195487.1 | 86.2% | 92% | (many diffs) |
| 18 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | XM_006524191.1 | 83% | 89% | (many diffs) |
| 19 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | XM_011246412.2 | 46.4% | 3.7% | (many diffs) |
| 20 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | XM_011246413.1 | 46.2% | 45.7% | (many diffs) |
| 21 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | XR_001782073.1 | 24.2% | (many diffs) | |
| 22 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | NR_036615.1 | 23.5% | (many diffs) | |
| 23 | mouse | 225027 | Srsf7 | serine/arginine-rich splici... | XR_876493.1 | 21.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 780
- ORF length:
- 714
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gcgttacggg cggtacggag gagaaaccaa ggtgtatgtt ggtaacctgg 121 gaactggcgc tggcaaagga gagttagaaa gggctttcag ttattatggt cctttaagaa 181 ctgtatggat tgcgagaaat cctccaggat ttgcctttgt ggaattcgaa gatcctagag 241 atgcagaaga tgcagtacga ggactggatg gaaaggtgat ttgtggctcc cgagtgaggg 301 ttgaactatc gacaggcatg cctcggagat cacgttttga tagaccacct gcccgacgtc 361 cctttgatcc aaatgataga tgctatgagt gtggcgaaaa gggacattat gcttatgatt 421 GTCATCGTTA CAGCCGGCGA AGAAGAAGCA GGTCACGGTC TAGATCACAT TCTCGATCCA 481 GAGGAAGGCG ATACTCTCGC TCACGCAGCA GGAGCAGGGG ACGAAGGTCA AGGTCAGCAT 541 CTCCTCGACG ATCAAGATCT ATCTCTCTTC GTAGATCAAG ATCAGCTTCA CTCAGAAGAT 601 CTAGGTCTGG TTCTATAAAA GGATCGAGGT ATTTCCAATC CCCGTCGAGG TCAAGATCAA 661 GATCCAGGTC TATTTCACGA CCAAGAAGCA GCCGATCAAA GTCCAGATCT CCATCTCCAA 721 AAAGAAGTCG TTCCCCATCA GGAAGTCCTC GCAGAAGTGC AAGTCCTGAA AGAATGGACT 781 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 841 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 901 TTTATATATC TTGTGGAAAG GACGAGCCCA GCAACTTAAA TCGTCGGATA CGCGTTAAGT 961 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt