Transcript: Human NM_001195811.1

Homo sapiens phospholipase D family member 5 (PLD5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PLD5 (200150)
Length:
3018
CDS:
127..1551

Additional Resources:

NCBI RefSeq record:
NM_001195811.1
NBCI Gene record:
PLD5 (200150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051789 GCCTGGTCCTAGATTTACAAA pLKO.1 713 CDS 100% 5.625 7.875 N PLD5 n/a
2 TRCN0000051790 CGAGGTGACGTACATGAACAT pLKO.1 552 CDS 100% 4.950 6.930 N PLD5 n/a
3 TRCN0000051788 GCGTTAGAGTTCGACTCCTTT pLKO.1 1064 CDS 100% 4.950 6.930 N PLD5 n/a
4 TRCN0000422142 CACACCTTTCCTAGGTTAAAT pLKO_005 1234 CDS 100% 15.000 10.500 N PLD5 n/a
5 TRCN0000413170 AGCATCATTAAGCAACTTAAA pLKO_005 1381 CDS 100% 13.200 9.240 N PLD5 n/a
6 TRCN0000051791 GAGCAGCTTATATTGGAAATT pLKO.1 1280 CDS 100% 13.200 9.240 N PLD5 n/a
7 TRCN0000431928 GGACAAACAGCACGTGTATAT pLKO_005 618 CDS 100% 13.200 9.240 N PLD5 n/a
8 TRCN0000413527 GATGTAACAGCTGATTCAAAG pLKO_005 502 CDS 100% 10.800 7.560 N PLD5 n/a
9 TRCN0000051792 CTTCAGTTGAATGAAACCAAA pLKO.1 835 CDS 100% 4.950 3.465 N PLD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13381 pDONR223 100% 93.8% 93.8% None 1_87del n/a
2 ccsbBroad304_13381 pLX_304 0% 93.8% 93.8% V5 1_87del n/a
3 TRCN0000467753 ACCCAGAAAACGTTTTATAAAGAT pLX_317 31.8% 93.8% 93.8% V5 1_87del n/a
Download CSV