Construct: ORF TRCN0000467753
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003200.1_s317c1
- Derived from:
- ccsbBroadEn_13381
- DNA Barcode:
- ACCCAGAAAACGTTTTATAAAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLD5 (200150)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467753
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 200150 | PLD5 | phospholipase D family memb... | XM_011544115.2 | 100% | 100% | |
| 2 | human | 200150 | PLD5 | phospholipase D family memb... | XM_011544116.2 | 100% | 100% | |
| 3 | human | 200150 | PLD5 | phospholipase D family memb... | NM_001320272.2 | 98.7% | 95.1% | 0_1insATGGGAGAGG;43_49delGGTAAGA |
| 4 | human | 200150 | PLD5 | phospholipase D family memb... | XM_017000567.2 | 98.7% | 95.1% | 0_1insATGGGAGAGG;43_49delGGTAAGA |
| 5 | human | 200150 | PLD5 | phospholipase D family memb... | XM_017000568.2 | 98.7% | 95.1% | 0_1insATGGGAGAGG;43_49delGGTAAGA |
| 6 | human | 200150 | PLD5 | phospholipase D family memb... | NM_001195811.1 | 93.8% | 93.8% | 1_87del |
| 7 | human | 200150 | PLD5 | phospholipase D family memb... | XM_024453867.1 | 90.2% | 90.2% | 1_144del |
| 8 | human | 200150 | PLD5 | phospholipase D family memb... | XM_011544119.2 | 84.3% | 74.7% | (many diffs) |
| 9 | human | 200150 | PLD5 | phospholipase D family memb... | NM_001372062.1 | 83% | 83% | 1_273del |
| 10 | human | 200150 | PLD5 | phospholipase D family memb... | NM_001195812.2 | 73.7% | 73.7% | 0_1ins351 |
| 11 | human | 200150 | PLD5 | phospholipase D family memb... | XM_011544120.2 | 73.7% | 73.7% | 0_1ins351 |
| 12 | human | 200150 | PLD5 | phospholipase D family memb... | XM_011544121.2 | 73.7% | 73.7% | 0_1ins351 |
| 13 | human | 200150 | PLD5 | phospholipase D family memb... | XM_011544122.3 | 73.7% | 73.7% | 0_1ins351 |
| 14 | human | 200150 | PLD5 | phospholipase D family memb... | XM_017000569.1 | 73.7% | 73.7% | 0_1ins351 |
| 15 | human | 200150 | PLD5 | phospholipase D family memb... | XM_017000570.2 | 73.7% | 73.7% | 0_1ins351 |
| 16 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_011238826.2 | 87.1% | 90.3% | (many diffs) |
| 17 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_017321154.1 | 87.1% | 90.3% | (many diffs) |
| 18 | mouse | 319455 | Pld5 | phospholipase D family, mem... | NM_001195816.1 | 82.9% | 87.5% | (many diffs) |
| 19 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_006496898.3 | 73.7% | 77.3% | (many diffs) |
| 20 | mouse | 319455 | Pld5 | phospholipase D family, mem... | NM_176916.4 | 73.3% | 77.4% | (many diffs) |
| 21 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_011238827.2 | 66.8% | 69.2% | (many diffs) |
| 22 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_006496900.3 | 64.8% | 67.8% | (many diffs) |
| 23 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_011238828.1 | 64.8% | 67.8% | (many diffs) |
| 24 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_011238829.2 | 64.8% | 67.8% | (many diffs) |
| 25 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_017321175.1 | 64.8% | 67.8% | (many diffs) |
| 26 | mouse | 319455 | Pld5 | phospholipase D family, mem... | XM_006496897.3 | 64.8% | 68% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1404
- ORF length:
- 1335
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggagaggat gaggatggac tctcagaaaa aaattgccaa aataaatgtc 121 gaattgccct ggtggaaaat attcctgaag gccttaacta ttcagaaaat gcaccatttc 181 acttatcact tttccaaggc tggatgaatt tactcaacat ggccaaaaag tctgttgaca 241 tagtgtcttc ccattgggat ctcaaccaca ctcatccatc agcatgtcag ggtcaacgtc 301 tttttgaaaa gttgctccag ctgacttcgc aaaatattga aatcaagcta gtgagtgatg 361 taacagctga ttcaaaggta ttagaagcct tgaaattaaa gggagccgag gtgacgtaca 421 tgaacatgac cgcttacaac aagggccggc tgcagtcctc cttctggatc gtggacaaac 481 agcacgtgta tatcggcagt gccggtttgg actggcaatc cctgggacag atgaaagaac 541 tcggtgtcat cttctacaac tgcagctgcc tggtcctaga tttacaaagg atatttgctc 601 tatatagttc attaaaattc aaaagcagag tgcctcaaac ctggtccaaa agactctatg 661 gagtctatga caatgaaaag aaattgcaac ttcagttgaa tgaaaccaaa tctcaagcat 721 ttgtatcgaa ttctccaaaa ctcttttgcc ctaaaaacag aagttttgac atagatgcca 781 tctacagtgt gatagatgat gccaagcagt atgtgtacat cgctgtcatg gactacctgc 841 ctatctccag cacaagcacc aaaaggactt actggccaga cttggatgca aaaataagag 901 aagcattagt tttacgaagc gttagagttc gactcctttt aagcttctgg aaggaaactg 961 atccccttac gtttaacttt atTTCATCTC TTAAAGCGAT TTGCACTGAA ATAGCCAACT 1021 GCAGTTTGAA AGTTAAATTT TTTGATCTGG AAAGAGAGAA TGCTTGTGCT ACAAAAGAAC 1081 AAAAGAATCA CACCTTTCCT AGGTTAAATC GCAACAAGTA CATGGTGACA GATGGAGCAG 1141 CTTATATTGG AAATTTTGAT TGGGTAGGGA ATGATTTCAC TCAGAATGCT GGCACGGGCC 1201 TTGTTATCAA CCAGGCAGAT GTGAGGAACA ACAGAAGCAT CATTAAGCAA CTTAAAGATG 1261 TGTTTGAAAG GGACTGGTAT TCACCGTATG CCAAAACCTT ACAGCCAACC AAACAGCCGA 1321 ACTGCTCAAG CCTGTTCAAA CTCAAACCCC TCTCCAACAA AACTGCCACA GACGACACAG 1381 GCGGAAAGGA TCCCCGGAAC GTATTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1441 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1501 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CCCAGAAAAC 1561 GTTTTATAAA GATACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1621 att