Transcript: Human NM_001197327.2

Homo sapiens heat shock protein family A (Hsp70) member 12B (HSPA12B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
HSPA12B (116835)
Length:
3130
CDS:
128..2185

Additional Resources:

NCBI RefSeq record:
NM_001197327.2
NBCI Gene record:
HSPA12B (116835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001197327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431443 AGTTTGGCGACACCGAAATTA pLKO_005 2097 CDS 100% 15.000 21.000 N HSPA12B n/a
2 TRCN0000427137 CAAGGACTGAACGGGTAAGAG pLKO_005 2415 3UTR 100% 4.950 6.930 N HSPA12B n/a
3 TRCN0000426709 GCAGCGTGAACTTCGTGAAGT pLKO_005 1422 CDS 100% 4.950 6.930 N HSPA12B n/a
4 TRCN0000130497 GCTCTACTTCGAGAAGTTCAA pLKO.1 538 CDS 100% 4.950 6.930 N HSPA12B n/a
5 TRCN0000130271 CCATCGACTTTCTTTCCAACT pLKO.1 2163 CDS 100% 4.050 2.835 N HSPA12B n/a
6 TRCN0000149737 GAATGTCTTGTGAAGCCATGA pLKO.1 1464 CDS 100% 4.050 2.835 N HSPA12B n/a
7 TRCN0000130294 CCACCCAAATATGACTGTGAA pLKO.1 2732 3UTR 100% 4.950 2.970 N HSPA12B n/a
8 TRCN0000150070 CGAGAAGTTCAAGATGAAGAT pLKO.1 547 CDS 100% 4.950 2.970 N HSPA12B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09435 pDONR223 100% 99.8% 99.8% None 556_557insAGG;1878C>T n/a
2 ccsbBroad304_09435 pLX_304 0% 99.8% 99.8% V5 556_557insAGG;1878C>T n/a
3 TRCN0000479290 TATCCTCAAGCTTACCCGAACAGT pLX_317 21.2% 99.8% 99.8% V5 556_557insAGG;1878C>T n/a
Download CSV