Transcript: Human NM_001198611.1

Homo sapiens microtubule associated protein 7 (MAP7), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MAP7 (9053)
Length:
4401
CDS:
250..2454

Additional Resources:

NCBI RefSeq record:
NM_001198611.1
NBCI Gene record:
MAP7 (9053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304055 ATGGGAGAGCAGCGTTGTTAA pLKO_005 864 CDS 100% 13.200 18.480 N MAP7 n/a
2 TRCN0000108435 GCCCTCTTACATAATGTATTT pLKO.1 3116 3UTR 100% 13.200 18.480 N MAP7 n/a
3 TRCN0000108438 CGACTTGAGGAGATTATGAAA pLKO.1 2008 CDS 100% 5.625 7.875 N MAP7 n/a
4 TRCN0000300363 CGACTTGAGGAGATTATGAAA pLKO_005 2008 CDS 100% 5.625 7.875 N MAP7 n/a
5 TRCN0000303999 ACTTACCCATTGGATCTAAAC pLKO_005 2294 CDS 100% 10.800 8.640 N MAP7 n/a
6 TRCN0000108436 GCACCTTTAGTGAAGGTAGAA pLKO.1 1408 CDS 100% 0.495 0.396 N MAP7 n/a
7 TRCN0000331347 TAGAGTTCTTGACCATCATTT pLKO_005 2555 3UTR 100% 13.200 9.240 N MAP7 n/a
8 TRCN0000108439 AGCCCAGAAATTCCTTTGAAT pLKO.1 2344 CDS 100% 5.625 3.938 N MAP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07349 pDONR223 100% 91.2% 89.3% None (many diffs) n/a
2 ccsbBroad304_07349 pLX_304 0% 91.2% 89.3% V5 (many diffs) n/a
3 TRCN0000466270 TGATTATCATCGAGACCCGACAGC pLX_317 13.8% 91.2% 89.3% V5 (many diffs) n/a
Download CSV