Transcript: Human NM_001198756.1

Homo sapiens G protein subunit gamma transducin 2 (GNGT2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GNGT2 (2793)
Length:
930
CDS:
181..390

Additional Resources:

NCBI RefSeq record:
NM_001198756.1
NBCI Gene record:
GNGT2 (2793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036854 TCCGATTTCCAAAGCGGGAAA pLKO.1 261 CDS 100% 0.405 0.567 N GNGT2 n/a
2 TRCN0000036856 AGAAAGGTGGCTGTCTGATAA pLKO.1 365 CDS 100% 13.200 9.240 N GNGT2 n/a
3 TRCN0000435291 AGTAAAGATCCCTGAACAAAT pLKO_005 496 3UTR 100% 13.200 9.240 N GNGT2 n/a
4 TRCN0000429000 CTTCATCACAGAATGAGTAAA pLKO_005 481 3UTR 100% 13.200 9.240 N GNGT2 n/a
5 TRCN0000036857 CAAAGCGGGAAAGGAAATCAA pLKO.1 270 CDS 100% 5.625 3.938 N GNGT2 n/a
6 TRCN0000036858 CCAAGCAGGAAACGATCCTTT pLKO.1 306 CDS 100% 4.950 3.465 N GNGT2 n/a
7 TRCN0000036855 CACAAGAATTCCGATTTCCAA pLKO.1 252 CDS 100% 0.000 0.000 N GNGT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00661 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00661 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466593 CAATGATTTCAGCATGCTAGCCTA pLX_317 100% 100% 100% V5 n/a
Download CSV