Transcript: Mouse NM_001198825.1

Mus musculus amyloid beta (A4) precursor protein (App), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
App (11820)
Length:
3266
CDS:
150..2351

Additional Resources:

NCBI RefSeq record:
NM_001198825.1
NBCI Gene record:
App (11820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054875 CGTTGCCTAGTTGGTGAGTTT pLKO.1 495 CDS 100% 4.950 3.960 N App n/a
2 TRCN0000301473 CGTTGCCTAGTTGGTGAGTTT pLKO_005 495 CDS 100% 4.950 3.960 N App n/a
3 TRCN0000054874 CGGATATGAGAATCCAACTTA pLKO.1 2303 CDS 100% 5.625 3.938 N App n/a
4 TRCN0000301472 CGGATATGAGAATCCAACTTA pLKO_005 2303 CDS 100% 5.625 3.938 N App n/a
5 TRCN0000054873 CCTGTTCATCATAAGCACTTT pLKO.1 3066 3UTR 100% 4.950 3.465 N App n/a
6 TRCN0000301544 CCTGTTCATCATAAGCACTTT pLKO_005 3066 3UTR 100% 4.950 3.465 N App n/a
7 TRCN0000054876 GCTGAGGAGATTCAAGATGAA pLKO.1 1755 CDS 100% 4.950 3.465 N App n/a
8 TRCN0000301470 GCTGAGGAGATTCAAGATGAA pLKO_005 1755 CDS 100% 4.950 3.465 N App n/a
9 TRCN0000054877 GCTGATGTTGAGGAAGAGGAA pLKO.1 852 CDS 100% 2.640 1.848 N App n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489725 CCATTTGTTTAATCGGTTTCATTC pLX_317 17.3% 80.3% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488121 TATATTTGTCGTTCATTTAGTTTT pLX_317 14.2% 80.2% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489208 GGCGGCCGGTGCCCTGCTTTGACC pLX_317 18.5% 80.2% 87% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10683 pDONR223 100% 36.1% 38% None (many diffs) n/a
5 ccsbBroad304_10683 pLX_304 0% 36.1% 38% V5 (many diffs) n/a
6 TRCN0000479912 GGTACCCAGATTCAGTATATAAGT pLX_317 43.5% 36.1% 38% V5 (many diffs) n/a
Download CSV